AV006767 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AV006767

Symbol: AV006767
Also known as:
RGD ID: 5027399
Expected Size: 145 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01091,753,106 - 91,753,247NCBIRnor6.0
Rnor_6.01011,153,249 - 11,153,805NCBIRnor6.0
Rnor_5.0109,918,607 - 9,919,163UniSTSRnor5.0
Rnor_5.01091,519,598 - 91,519,739UniSTSRnor5.0
RGSC_v3.41092,847,314 - 92,847,455UniSTSRGSC3.4
RGSC_v3.41011,079,293 - 11,079,849UniSTSRGSC3.4
Celera1087,302,071 - 87,302,212UniSTS
Celera109,912,221 - 9,912,777UniSTS
Cytogenetic Map10q12UniSTS
Cytogenetic Map10q32.1UniSTS
Is Marker For: Genes:   Gosr2   Magmas-ps1   Pam16  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGCCCAGCAGATTCTCAAT
Reverse Primer TCTAGACGTTCCTTTGCACG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2510Dnase1deoxyribonuclease 1101175768111760672Rat
71038Gdf9growth differentiation factor 9103878251938793238Rat
68424Dlg4discs large MAGUK scaffold protein 4105662584556655543Rat
3877Tnfaip1TNF alpha induced protein 1106579100265805693Rat
69423Srebf1sterol regulatory element binding transcription factor 1104657099646593021Rat
68405Atp6v0a1ATPase H+ transporting V0 subunit a1108891426488967736Rat
68406Timm22translocase of inner mitochondrial membrane 22106455606464563822Rat
68408Lasp1LIM and SH3 protein 1108574466285785130Rat
68943Cacna1hcalcium voltage-gated channel subunit alpha1 H101473093214789201Rat
68949Il13interleukin 13103898290938985466Rat
2054Adra1badrenoceptor alpha 1B102939276229450644Rat
2875Igfbp4insulin-like growth factor binding protein 4108695055586962563Rat
3702Slc22a5solute carrier family 22 member 5103920110139228090Rat
3644Ccl11C-C motif chemokine ligand 11106943496569439566Rat
3645Ccl2C-C motif chemokine ligand 2106941206569413863Rat
61817Col1a1collagen type I alpha 1 chain108274580182762790Rat
3575Pdlim4PDZ and LIM domain 4103939057839405322Rat
3927Ubtfupstream binding transcription factor109025027590265772Rat
3942Unc119unc-119 lipid binding chaperone106560691965612324Rat
3949Vamp2vesicle-associated membrane protein 2105567517155679405Rat
3612Ncor1nuclear receptor co-repressor 1104862912148772890Rat
3647Ccl3C-C motif chemokine ligand 3107086951670871066Rat
68432Cldn7claudin 7105657632656578632Rat
2218Brca1BRCA1, DNA repair associated108939482189455093Rat
619980Hdac5histone deacetylase 5109014018390169853Rat
3967Vtnvitronectin106576796065771040Rat
2541Efnb3ephrin B3105616143156168819Rat
71074Lhx1LIM homeobox 1107184399171849293Rat
3177Ngfrnerve growth factor receptor108338982883408061Rat
3192Npm1nucleophosmin 1101808094918091062Rat
71093Gosr1golgi SNAP receptor complex member 1106340552663442257Rat
71101Abcc3ATP binding cassette subfamily C member 3108204730882116928Rat
3297Pemtphosphatidylethanolamine N-methyltransferase104633982146404640Rat
3857Thrathyroid hormone receptor alpha108665728586684935Rat
2782Hba-a1hemoglobin alpha, adult chain 1101560279415603649Rat
68327Hap1huntingtin-associated protein 1108825797588266210Rat
619759Grb7growth factor receptor bound protein 7108639318686408893Rat
619773Epn2epsin 2104779549647857373Rat
619780Sez6seizure related 6 homolog106486580264915461Rat
619947Mpripmyosin phosphatase Rho interacting protein104601839746133580Rat
69069Ccl5C-C motif chemokine ligand 5107073976470744303Rat
69333Mslnmesothelin101511970015129129Rat
2161Asgr2asialoglycoprotein receptor 2105671044656723608Rat
2171Atp1b2ATPase Na+/K+ transporting subunit beta 2105620562256211879Rat
2175Atp2a3ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3105952884959560440Rat
619887Rps2ribosomal protein S2101408817114090020Rat
61889MefvMEFV innate immuity regulator, pyrin101204581312056229Rat
61892Eci1enoyl-CoA delta isomerase 1101379757313810918Rat
2088Aldh3a1aldehyde dehydrogenase 3 family, member A1104749016847499855Rat
3276Pctpphosphatidylcholine transfer protein107749144577537268Rat
2242Ca4carbonic anhydrase 4107227228672281069Rat
3534Rararetinoic acid receptor, alpha108683881986884224Rat
61830Kcnab3potassium voltage-gated channel subfamily A regulatory beta subunit 3105592722855933653Rat
61845Gfergrowth factor, augmenter of liver regeneration101405934714061703Rat
61855Gabra1gamma-aminobutyric acid type A receptor subunit alpha 1102731071827371802Rat
3322Phbprohibitin108347610783488878Rat
3350Pld2phospholipase D2105716192157181148Rat
3359Pmp22peripheral myelin protein 22104953858849568583Rat
3361Pnmtphenylethanolamine-N-methyltransferase108634089386342501Rat
619913Tekt1tektin 1105889568958924098Rat
61966Gabrg2gamma-aminobutyric acid type A receptor subunit gamma 2102709091327179786Rat
61983Grngranulin precursor109037710390383207Rat
70928Kif1ckinesin family member 1C105732225957352395Rat
69311Slit3slit guidance ligand 3101992420020517918Rat
2401CrebbpCREB binding protein101159099411721039Rat
2415Cryba1crystallin, beta A1106516077765167504Rat
3986Rnf112ring finger protein 112104771903447726050Rat
71002Decr22,4-dienoyl-CoA reductase 2101545185015460227Rat
71012Fzd2frizzled class receptor 2109055014790552057Rat
2644G6pc1glucose-6-phosphatase catalytic subunit 1108928600989296213Rat
2709Gipgastric inhibitory polypeptide108383508083848399Rat
3623Sbpspermine binding protein101328950213309338Rat
2900Il5interleukin 5103906671639069587Rat
69331Git1GIT ArfGAP 1106265600062664467Rat
69224Gpx3glutathione peroxidase 3104024743640255423Rat
3066Tpsab1tryptase alpha/beta 1101470125314703668Rat
61866Aldh3a2aldehyde dehydrogenase 3 family, member A2104752548647546535Rat
61875Psmb3proteasome 20S subunit beta 3108564664685653729Rat
620067Scpep1serine carboxypeptidase 1107623037176263866Rat
2786Hcrthypocretin neuropeptide precursor108866921688670430Rat
70493Alox15arachidonate 15-lipoxygenase105695369256962145Rat
3765Sstr5somatostatin receptor 5101484774914853827Rat
3779Stk10serine/threonine kinase 10101742096417521810Rat
70902Cntnap1contactin associated protein 1108908790489103615Rat
70906Aipl1aryl hydrocarbon receptor-interacting protein-like 1105859969058631194Rat
3742Sparcsecreted protein acidic and cysteine rich104074239040764232Rat
70367Vmp1vacuole membrane protein 1107390198874001900Rat
2349Chrnb1cholinergic receptor nicotinic beta 1 subunit105639067156403255Rat
2353Chrnecholinergic receptor nicotinic epsilon subunit105723896057246750Rat
619936Krt19keratin 19108805584388060560Rat
3385Ppypancreatic polypeptide109004158290043316Rat
2679Gfapglial fibrillary acidic protein109099076290999435Rat
2230C1qbpcomplement C1q binding protein105761387657618527Rat
3889Tp53tumor protein p53105618629956198449Rat
2961Kcnmb1potassium calcium-activated channel subfamily M regulatory beta subunit 1101891058618922856Rat
2650Gabrb2gamma-aminobutyric acid type A receptor subunit beta 2102797369428193072Rat
2662Gastgastrin108824553288248485Rat
2160Asgr1asialoglycoprotein receptor 1105666218856666086Rat
620014Mpp2membrane palmitoylated protein 2108999828490030766Rat
3139Myh4myosin heavy chain 4105377845653801605Rat
2018AclyATP citrate lyase108839224888442845Rat
70993Flot2flotillin 2106530490165329332Rat
62048Top2aDNA topoisomerase II alpha108690146786930947Rat
62062Mybbp1aMYB binding protein 1a105900040059010794Rat
62067Rpl23ribosomal protein L23108572139885725359Rat
71048Ap2b1adaptor related protein complex 2 subunit beta 1107051646270621973Rat
3714Slc6a4solute carrier family 6 member 4106315365663188377Rat
69428Pdk2pyruvate dehydrogenase kinase 2108283827082852758Rat
3671Shbgsex hormone binding globulin105621986156237354Rat
3240P2rx1purinergic receptor P2X 1105956626859581328Rat
69403Acsl6acyl-CoA synthetase long-chain family member 6103965477139717592Rat
69405Zfp354czinc finger protein 354C103631134336322356Rat
69409Galnt10polypeptide N-acetylgalactosaminyltransferase 10104306731643208992Rat
3185Nos2nitric oxide synthase 2106618829066221621Rat
3710Slc4a1solute carrier family 4 member 1 (Diego blood group)109029614490312401Rat
621456Pnpopyridoxamine 5'-phosphate oxidase108487492684881190Rat
628809Alox15barachidonate 15-lipoxygenase, type B105577374855783489Rat
708439Srcin1SRC kinase signaling inhibitor 1108546005985517671Rat
620307Pdpk13-phosphoinositide dependent protein kinase-1101344637313525248Rat
631328Tbkbp1TBK1 binding protein 1108507105885085596Rat
2364Cltcclathrin heavy chain107401456074070578Rat
727914Rab40cRab40c, member RAS oncogene family101524791315283111Rat
68359Pttg1PTTG1 regulator of sister chromatid separation, securin102901433229026088Rat
620683Rps6kb1ribosomal protein S6 kinase B1107382420073865503Rat
620684Synrgsynergin, gamma107127869871357791Rat
620685Aatfapoptosis antagonizing transcription factor107174464871837851Rat
621505Mapk7mitogen-activated protein kinase 7104776859247775130Rat
621693Aspaaspartoacylase105983969359888244Rat
621235Ndel1nudE neurodevelopment protein 1-like 1105539891955456654Rat
619957Wfdc18WAP four-disulfide core domain 18107100870971010863Rat
621393Atp6v0e1ATPase H+ transporting V0 subunit e1101676985716792930Rat
621394Atp6v0cATPase H+ transporting V0 subunit C101353703113543407Rat
628674Zfp597zinc finger protein 597101191224511917919Rat
620412Jupjunction plakoglobin108828051788307451Rat
621859Ppp1r1bprotein phosphatase 1, regulatory (inhibitor) subunit 1B108630372786312770Rat
2393Cpdcarboxypeptidase D106332576463389811Rat
2897Il3interleukin 3103962053539622973Rat
2898Il4interleukin 4103896397938969531Rat
2907Il9rinterleukin 9 receptor101569721615708684Rat
2909Kpnb1karyopherin subunit beta 1108509651785124641Rat
2704Glra1glycine receptor, alpha 1104085195540954364Rat
628827Nr1d1nuclear receptor subfamily 1, group D, member 1108668387586690815Rat
619962Npeppsaminopeptidase puromycin sensitive108514036885222861Rat
621536Kif3akinesin family member 3a103891870538953958Rat
628842Tac4tachykinin precursor 4108308116883089487Rat
619765Xylt2xylosyltransferase 2108238600382399485Rat
628841Trpv1transient receptor potential cation channel, subfamily V, member 1105979912359824208Rat
620392Ube2g1ubiquitin-conjugating enzyme E2G 1105917326859254458Rat
621710Pip4k2bphosphatidylinositol-5-phosphate 4-kinase type 2 beta108565522385684138Rat
708470Ifi47interferon gamma inducible protein 47103427799334285623Rat
619811Ntn3netrin 3101357772513580821Rat
628766Casc3CASC3 exon junction complex subunit108672453486744485Rat
620699Rhbdl1rhomboid like 1101520150315205856Rat
631335Obscnobscurin, cytoskeletal calmodulin and titin-interacting RhoGEF104535318545483570Rat
621415Kcnh4potassium voltage-gated channel subfamily H member 4108864534188667447Rat
620757Pex12peroxisomal biogenesis factor 12107051278570516494Rat
2336Chadchondroadherin108229029682296146Rat
727858Npwneuropeptide W101402118714022452Rat
727863Per1period circadian regulator 1105568176155696557Rat
621321Myo1dmyosin ID106786693968142864Rat
70886Kcnip1potassium voltage-gated channel interacting protein 1101855812818942677Rat
619743Lcp2lymphocyte cytosolic protein 2101899652319043289Rat
620207Prpsap2phosphoribosyl pyrophosphate synthetase-associated protein 2104800879948044435Rat
727783Slc35b1solute carrier family 35, member B1108320153283208605Rat
620152Spag5sperm associated antigen 5106555278065585773Rat
621126Tob1transducer of ErbB-2.1108191368981915727Rat
69290Trim17tripartite motif-containing 17104530700745314823Rat
620656Fat2FAT atypical cadherin 2104058302540682598Rat
708560Coro6coronin 6106269195262700658Rat
3004Lgals5galectin 5106622601566229293Rat
628704Il12binterleukin 12B103003444730048774Rat
620441Ccl4C-C motif chemokine ligand 4107087092670886357Rat
3333Pkd1polycystin 1, transient receptor potential channel interacting101391405713962008Rat
628785Krt9keratin 9108810251988107232Rat
727941Aoc2-ps1amine oxidase, copper containing 2, pseudogene 1108924559089247056Rat
708422Olr1361olfactory receptor 1361101233214212333083Rat
621155Nmur2neuromedin U receptor 2104139266341408518Rat
620256P2rx5purinergic receptor P2X 5105972543859737126Rat
3005Lgals9galectin 9106473702264760195Rat
3012Llgl1LLGL scribble cell polarity complex component 1104694087346955524Rat
2426Csf3colony stimulating factor 3108661678586619160Rat
61917Stx8syntaxin 8105451292254753302Rat
69229Rack1receptor for activated C kinase 1103414971734155198Rat
69242Mlst8MTOR associated protein, LST8 homolog101383925013845001Rat
708345Ube2bubiquitin-conjugating enzyme E2B103743994737454867Rat
620455Slfn4schlafen family member 4107041168670435162Rat
708487Adap2ArfGAP with dual PH domains 2106749485167527582Rat
61933Atp5mc1ATP synthase membrane subunit c locus 1108389594183898640Rat
621722Fbxl20F-box and leucine-rich repeat protein 20108603674586099699Rat
727791LOC257650hippyragranin108622252586236889Rat
727870Prss21serine protease 21101321434313219994Rat
727875G6pc3glucose 6 phosphatase catalytic subunit 3109013419390138425Rat
68360Dbil5diazepam binding inhibitor-like 5106437592664376938Rat
621644Itgaeintegrin subunit alpha E105965232459711885Rat
620097Mgat1alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase103451839234537214Rat
621660Kcnj12potassium inwardly-rectifying channel, subfamily J, member 12104728220847343501Rat
620767P3h4prolyl 3-hydroxylase family member 4108831823188325326Rat
735025Olr1398olfactory receptor 1398103474405934744994Rat
735028Ppm1eprotein phosphatase, Mg2+/Mn2+ dependent, 1E107454827074679858Rat
620693Nxph3neurexophilin 3108332926383332929Rat
620532Gabrpgamma-aminobutyric acid type A receptor subunit pi101848425718510604Rat
727970Rhot2ras homolog family member T2101520594315211739Rat
620519Doc2bdouble C2 domain beta106392125563952944Rat
62077SeboxSEBOX homeobox106577137065774748Rat
62079Gosr2golgi SNAP receptor complex member 2109173577291756123Rat
2920Irf1interferon regulatory factor 1103910953039116532Rat
619874Cdkl3cyclin-dependent kinase-like 3103745839737510345Rat
619877Nme2NME/NM23 nucleoside diphosphate kinase 2108164821681653717Rat
619879Nme3NME/NM23 nucleoside diphosphate kinase 3101425823214259365Rat
621111Cdk12cyclin-dependent kinase 12108615718686210657Rat
708476Slc25a11solute carrier family 25 member 11105726590357268018Rat
1304913Mrpl45mitochondrial ribosomal protein L45108525787685269806Rat
621737Flt4Fms related receptor tyrosine kinase 4103507878235120296Rat
621743Ddx52DExD-box helicase 52107125366771276397Rat
621541Olr1413olfactory receptor 1413104389442943895376Rat
708563Tspoap1TSPO associated protein 1107505395675079615Rat
621625Aurkbaurora kinase B105562586055632399Rat
621118Nlgn2neuroligin 2105643158656444847Rat
621149Slc22a4solute carrier family 22 member 4103933497239373508Rat
621158Clec10aC-type lectin domain containing 10A105676492756769447Rat
620191Caskin1CASK interacting protein 1101385310713874254Rat
621172Anxa6annexin A6104032058140375605Rat
621183Rpl19ribosomal protein L19108597869185981979Rat
621192Rpl27ribosomal protein L27108935286489356563Rat
621206Hand1heart and neural crest derivatives expressed 1104325072943253296Rat
628878Hspa4heat shock protein family A (Hsp70) member 4103860162438642397Rat
628882Elac2elaC ribonuclease Z 2105147837851501167Rat
628889Gjc1gap junction protein, gamma 1109078140890912440Rat
620492Slc36a2solute carrier family 36 member 2104049718440525033Rat
621684Atox1antioxidant 1 copper chaperone104079085040805886Rat
727962Pigwphosphatidylinositol glycan anchor biosynthesis, class W107219477472198415Rat
727966Kat7lysine acetyltransferase 7108309506783128342Rat
628847Mapk9mitogen-activated protein kinase 9103533385935374364Rat
621065Csf2colony stimulating factor 2103960208939604070Rat
620437Piglphosphatidylinositol glycan anchor biosynthesis, class L104877401848831848Rat
708553Thoc6THO complex 6101298913512994495Rat
68382Cacnb1calcium voltage-gated channel auxiliary subunit beta 1108595413885974764Rat
620270Glp2rglucagon-like peptide 2 receptor105426029054323839Rat
620953Ebf1EBF transcription factor 1102365484924051627Rat
619801Slc36a1solute carrier family 36 member 1104053801340573304Rat
619809Ntn1netrin 1105476192554982072Rat
3166Neurod2neuronal differentiation 2108628086586282681Rat
3168Nf1neurofibromin 1106673246066928706Rat
620438Gucy2dguanylate cyclase 2D, retinal105583569555851235Rat
620443Myo1cmyosin 1C106380331163819614Rat
727901Scgb3a1secretoglobin, family 3A, member 1103513356135134868Rat
727907Tenm2teneurin transmembrane protein 2102084609121791771Rat
628759Prop1PROP paired-like homeobox 1103644992036452381Rat
1304668Blmhbleomycin hydrolase106319736763240447Rat
2561Erbb2erb-b2 receptor tyrosine kinase 2108636759686391728Rat
621270Arf1ADP-ribosylation factor 1104556270045579214Rat
620015Mpp3membrane palmitoylated protein 3108993027089959462Rat
2967Zfp354azinc finger protein 354A103658649536600172Rat
620677Ltc4sleukotriene C4 synthase103573648635743088Rat
67401Ccnfcyclin F101359468713619935Rat
62031Coilcoilin107632067676336169Rat
1303226Dnajc7DnaJ heat shock protein family (Hsp40) member C7108849827188533730Rat
621531Gria1glutamate ionotropic receptor AMPA type subunit 1104244172342760200Rat
621885Psmc3ipPSMC3 interacting protein108900210989006075Rat
621200Elobelongin B101316303213168217Rat
620520Nkx2-5NK2 homeobox 5101663598916638758Rat
632281Ppp1r9bprotein phosphatase 1, regulatory subunit 9B108280070482816735Rat
1303147Wfdc21WAP four-disulfide core domain 21107104732671053195Rat
2368Cnp2',3'-cyclic nucleotide 3' phosphodiesterase108849079888497357Rat
69358Sostsclerostin108989708789900131Rat
1304924Eme2essential meiotic structure-specific endonuclease subunit 2101425355214257017Rat
1304926Pfasphosphoribosylformylglycinamidine synthase105557188155593384Rat
1304934Rpusd1RNA pseudouridine synthase domain containing 1101509910415102968Rat
631374Slc13a5solute carrier family 13 member 5105880658158835549Rat
62000Ywhaetyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon106388433863921709Rat
620890Rab26RAB26, member RAS oncogene family101389427113898578Rat
621140G3bp1G3BP stress granule assembly factor 1104081285840846252Rat
2017Asic2acid sensing ion channel subunit 2106824780069347223Rat
2295Ccng1cyclin G1102590392525910298Rat
3065Tpsb2tryptase beta 2101472267214724464Rat
735046Prp2l1proline rich protein 2-like 1109161066291690865Rat
69195Nbr1NBR1, autophagy cargo receptor108945520289483791Rat
1303032Krt39keratin 39108743085087437455Rat
727898Col23a1collagen type XXIII alpha 1 chain103484661834934991Rat
735142Prss30protease, serine, 30101334828913355833Rat
621562Ubbubiquitin B104888023148881896Rat
620182Nup88nucleoporin 88105758182857606171Rat
3106MpgN-methylpurine-DNA glycosylase101566176815667995Rat
621517Crlf3cytokine receptor-like factor 3106738366467401836Rat
1304829Med13mediator complex subunit 13107370232773787084Rat
1304854Plekhh3pleckstrin homology, MyTH4 and FERM domain containing H3108907646789084952Rat
1304861Cuedc1CUE domain containing 1107549581775516280Rat
1304870RGD1304870similar to Tceb2 protein107627874776281411Rat
2747Grm6glutamate metabotropic receptor 6103634550336363416Rat
61881Psmb6proteasome 20S subunit beta 6105713133957133685Rat
2779Haghhydroxyacyl glutathione hydrolase101421591314230506Rat
3970Foxn1forkhead box N1106562114265634666Rat
628642Nmt1N-myristoyltransferase 1109112668991160721Rat
628646Krt20keratin 20108734251487351045Rat
1303181Krt17keratin 17108815899388163712Rat
1305687Rnasekribonuclease K105684836756850085Rat
621542Rad50RAD50 double strand break repair protein103900213039054042Rat
621550Gas7growth arrest specific 7105401072354240805Rat
727812Rtn4rl1reticulon 4 receptor-like 1106203586662109075Rat
735057Rundc3aRUN domain containing 3A109034203390351172Rat
1304875Dlx3distal-less homeobox 3108293797182943367Rat
631432Slu7SLU7 homolog, splicing factor102902955629044919Rat
708436Skap1src kinase associated phosphoprotein 1108430937984619051Rat
727975Hcfc1r1host cell factor C1 regulator 1101299422912995674Rat
2836Hsd17b1hydroxysteroid (17-beta) dehydrogenase 1108898755888989758Rat
2805Hmmrhyaluronan-mediated motility receptor102586149025890639Rat
708577Csap1common salivary protein 1101323018113230577Rat
631355Tpsg1tryptase gamma 1101472453114731259Rat
619727Rasd1ras related dexamethasone induced 1104633036146339326Rat
3965Trpv2transient receptor potential cation channel, subfamily V, member 2104890354048925036Rat
629472Cdk5r1cyclin-dependent kinase 5 regulatory subunit 1106786205467863255Rat
735061Myh1myosin heavy chain 1105374084153764610Rat
1304560Fahd1fumarylacetoacetate hydrolase domain containing 1101421451814215957Rat
1302969Phf23PHD finger protein 23105660507856609236Rat
1302978Ggnbp2gametogenetin binding protein 2107215672972188834Rat
1303200Ccl6chemokine (C-C motif) ligand 6107079811870802750Rat
2050Adora2badenosine A2B receptor104856956348586366Rat
2091Aldocaldolase, fructose-bisphosphate C106558650465590093Rat
620897Dusp1dual specificity phosphatase 1101697064216973425Rat
631329Tnfrsf12aTNF receptor superfamily member 12A101299590412997930Rat
69287Sqstm1sequestosome 1103570472835716316Rat
3774Stat5bsignal transducer and activator of transcription 5B108868620788712313Rat
1302937Krt13keratin 13108803213088036040Rat
1303335Ggt6gamma-glutamyl transferase 6105899525358998431Rat
620799Bnip1BCL2 interacting protein 1101667707716689321Rat
2555Eno3enolase 3105727827157283661Rat
3908Tsc2TSC complex subunit 2101396200613996684Rat
631369Serpinf1serpin family F member 1106224175062254145Rat
1304590Rap1gap2RAP1 GTPase activating protein 2106117793661395856Rat
1304598Abhd15abhydrolase domain containing 15106264345362648844Rat
68429Igfalsinsulin-like growth factor binding protein, acid labile subunit101424030814243554Rat
620342Rph3alrabphilin 3A-like (without C2 domains)106398955664140584Rat
620354Myh2myosin heavy chain 2105371189553738164Rat
620356Myh8myosin heavy chain 8105381881853848490Rat
620840Hnrnph1heterogeneous nuclear ribonucleoprotein H1103587261935879911Rat
1304601Amdhd2amidohydrolase domain containing 2101352840013536949Rat
1304611Zfp496zinc finger protein 496104583325945852130Rat
621777Stc2stanniocalcin 2101654290916552675Rat
621799Dnah9dynein, axonemal, heavy chain 9105235122652711289Rat
62023Camkk1calcium/calmodulin-dependent protein kinase kinase 1105958502359608180Rat
621248Acacaacetyl-CoA carboxylase alpha107151939271719910Rat
1306819Ptrh2peptidyl-tRNA hydrolase 2107400215174012182Rat
1303303Elp5elongator acetyltransferase complex subunit 5105657898056590706Rat
735202Arhgap27Rho GTPase activating protein 27109141853591451831Rat
1304897Rpl23aribosomal protein L23a106544129565443981Rat
1304900Zfp598zinc finger protein 598101403511414047100Rat
1304902Nlrc3NLR family, CARD domain containing 3101180953111844184Rat
621825Pfn1profilin 1105727300357275708Rat
620826Akap1A-kinase anchoring protein 1107615101376183987Rat
628651Gm2aGM2 ganglioside activator104043839440450927Rat
3137Myh13myosin heavy chain 13105392107753927553Rat
71000Myh10myosin heavy chain 10105527491055406738Rat
620190Becn1beclin 1108920994489225297Rat
621437Hist3h2ahistone cluster 3, H2a104529760345299155Rat
631401Wnk4WNK lysine deficient protein kinase 4108918113989198213Rat
620380Slc9a3r2SLC9A3 regulator 2101400333014015066Rat
1304726Smarce1SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1108711682787138890Rat
1304728RGD1304728similar to 4933427D14Rik protein105872672158776718Rat
1304577Zfp13zinc finger protein 13101290864312916784Rat
735087Spata20spermatogenesis associated 20108220261982217260Rat
735088Flcnfolliculin104615318546172331Rat
735094Srrserine racemase106175613861772327Rat
1304587RGD1304587similar to RIKEN cDNA 2310033P09104555849145562004Rat
3138Myh3myosin heavy chain 3105362137553645194Rat
2711Slc2a4solute carrier family 2 member 4105655292156558562Rat
2405CrkCRK proto-oncogene, adaptor protein106382973163855999Rat
628606Tubg1tubulin, gamma 1108903086589037455Rat
1303328Clint1clathrin interactor 1103083391431007813Rat
1303311Lrrc46leucine rich repeat containing 46108497167484983867Rat
1303322Krt26keratin 26108723972287248589Rat
3683LOC24906RoBo-1104387162843880549Rat
61872Ramp2receptor activity modifying protein 2108916617089168962Rat
1307463Krt14keratin 14108811802988122233Rat
62058Aoc3amine oxidase, copper containing 3108925137089259313Rat
2608Fgf18fibroblast growth factor 18101804710918082290Rat
621575Vdac1voltage-dependent anion channel 1103772491537752827Rat
1307802Noxo1NADPH oxidase organizer 1101406233114066918Rat
1306315Rpl3lribosomal protein L3-like101409476914105312Rat
1307415Dusp14dual specificity phosphatase 14107136368871383602Rat
1307421Foxi1forkhead box I1101916056619164505Rat
1307239Dhx33DEAH-box helicase 33105762202257638485Rat
708455Taok1TAO kinase 1106254287062630341Rat
1305204Rnf43ring finger protein 43107495641175028951Rat
1306416Epn3epsin 3108222076282231200Rat
1306708Traf4Tnf receptor associated factor 4106541868865424802Rat
1307515Adam11ADAM metallopeptidase domain 11109073126090749221Rat
1307520Hist3h2bahistone cluster 3, H2ba104528974145290370Rat
1307522Rnps1RNA binding protein with serine rich domain 1101378633913796720Rat
1307527Hic1HIC ZBTB transcriptional repressor 1106200715062010774Rat
1304747Adcy9adenylate cyclase 9101139269811515406Rat
3773Stat5asignal transducer and activator of transcription 5A108876473288789060Rat
1305113Nubp2nucleotide binding protein 2101424420114247930Rat
1305117Jpt2Jupiter microtubule associated homolog 2101430410814324170Rat
1305547Ints2integrator complex subunit 2107363280573690952Rat
1305548Stac2SH3 and cysteine rich domain 2108598836786004209Rat
1305553Telo2telomere maintenance 2101446158114476812Rat
2266Canxcalnexin103580094235833939Rat
1305914Hes7hes family bHLH transcription factor 7105570448555710523Rat
1305919Zfp213zinc finger protein 213101288553312892464Rat
1304714Eral1Era-like 12S mitochondrial rRNA chaperone 1106527284965291070Rat
1305130Zfp18zinc finger protein 18105232766852350944Rat
1305258Cwc25CWC25 spliceosome-associated protein homolog108568489885709568Rat
1307493Tlcd3aTLC domain containing 3A106436037464367679Rat
1307496Plxdc1plexin domain containing 1108587112285938085Rat
1305590Sar1bsecretion associated, Ras related GTPase 1B103721598937245603Rat
1307011Fxr2FMR1 autosomal homolog 2105623781456257877Rat
1306126Antkmtadenine nucleotide translocase lysine methyltransferase101516003715161895Rat
1305434Pkmyt1protein kinase, membrane associated tyrosine/threonine 1101306107713072277Rat
1305437Tex14testis expressed 14, intercellular bridge forming factor107472407074849172Rat
1305622Bod1biorientation of chromosomes in cell division 1101625972816266069Rat
1305623Mrps34mitochondrial ribosomal protein S34101425700114258132Rat
1304990Kctd5potassium channel tetramerization domain containing 5101342015213446323Rat
1305651Ccnqcyclin Q106601951966020682Rat
1306372Supt4h1SPT4 homolog, DSIF elongation factor subunit107503236575038547Rat
1305856Prss29serine protease 29101467828614681877Rat
1307363Nkiras2NFKB inhibitor interacting Ras-like 2108853656488540739Rat
1305092Lrrc59leucine rich repeat containing 59108235239082367047Rat
1305097Pcgf2polycomb group ring finger 2108563182985642591Rat
1305099Rufy1RUN and FYVE domain containing 1103588280535927268Rat
1305819Slc43a2solute carrier family 43 member 2106367631763719283Rat
1306039C1ql1complement C1q like 1109104000591047177Rat
620331Pafah1b1platelet-activating factor acetylhydrolase 1b, regulatory subunit 1106145614461577412Rat
1303097Gfpt2glutamine-fructose-6-phosphate transaminase 2103527923735325506Rat
69255Hnrnpabheterogeneous nuclear ribonucleoprotein A/B103495571334961662Rat
1306740Zfp692zinc finger protein 692104374073943752713Rat
61836Clcn7chloride voltage-gated channel 7101449284414518167Rat
61911GabarapGABA type A receptor-associated protein105660128856604223Rat
1305018Wnt9aWnt family member 9A104565904545686103Rat
1307319Snx11sorting nexin 11108462842084639125Rat
1307326Hs3st3b1heparan sulfate-glucosamine 3-sulfotransferase 3B1105036909750402584Rat
1307328Trim7tripartite motif-containing 7103418553534200750Rat
1307504Krtap3-3keratin associated protein 3-3108746800287468697Rat
1306989Dhrs7cdehydrogenase/reductase 7C105435227054370653Rat
1306996Psme3proteasome activator subunit 3108923625689244041Rat
1306401Cnot8CCR4-NOT transcription complex, subunit 8104353815043551271Rat
1306279AbrABR activator of RhoGEF and GTPase106456512164657079Rat
1305473Spag7sperm associated antigen 7105728498957291146Rat
1306896Igtpinterferon gamma induced GTPase104363108943639044Rat
1306897Nek8NIMA-related kinase 8106540448965439059Rat
3926Ube2iubiquitin-conjugating enzyme E2I101461861514639274Rat
1305068Ybx2Y box binding protein 2105654668956552339Rat
1305075Rhbdf1rhomboid 5 homolog 1101567237015685285Rat
1306320Pelp1proline, glutamate and leucine rich protein 1105698807657005111Rat
1305048Cyfip2cytoplasmic FMR1 interacting protein 2103127874631419235Rat
1305142Tbl3transducin (beta)-like 3101406698414072197Rat
1307966Fam171a2family with sequence similarity 171, member A2109038311190393476Rat
1307981Luc7l3LUC7-like 3 pre-mRNA splicing factor108199114782027119Rat
1307590FliiFLII, actin remodeling protein104695546046969468Rat
1307242Kat2alysine acetyltransferase 2A108861158688619558Rat
1305058Rab34RAB34, member RAS oncogene family106544811165452178Rat
1305063Rab11fip4RAB11 family interacting protein 4106694236367051672Rat
2014Acadvlacyl-CoA dehydrogenase, very long chain105661932156624468Rat
1307444Tmigd1transmembrane and immunoglobulin domain containing 1106326255463274598Rat
708580Igf2bp1insulin-like growth factor 2 mRNA binding protein 1108377417883823323Rat
1306450Psmd11proteasome 26S subunit, non-ATPase 11106781065567857562Rat
1307685Cavin1caveolae associated protein 1108886251388874495Rat
1307691RilpRab interacting lysosomal protein106365845163662428Rat
1308564RGD1308564similar to L-amino acid oxidase 1104371591143733329Rat
1307010Glod4glyoxalase domain containing 4106437992264398263Rat
1306656Inca1inhibitor of CDK, cyclin A1 interacting protein 1105730972257322140Rat
1306657Usp32ubiquitin specific peptidase 32107230017372474574Rat
1306728Tom1l2target of myb1 like 2 membrane trafficking protein104659939246720921Rat
1306729Bicdl2BICD family like cargo adaptor 2101298069612989133Rat
1307016Plscr3phospholipid scramblase 3105645263256458390Rat
1307022Poldip2DNA polymerase delta interacting protein 2106578199465790833Rat
1307023Rhot1ras homolog family member T1106755927767640622Rat
1307024Ikzf3IKAROS family zinc finger 3108642075786509454Rat
1306530Krt34keratin 34108795036487954055Rat
1305163Irgmimmunity-related GTPase M103421388534221968Rat
1304553Ifi35interferon-induced protein 35108935837689366628Rat
735141Eif4a1eukaryotic translation initiation factor 4A1105627125756276764Rat
735151Ccr7C-C motif chemokine receptor 7108705733587067444Rat
1307376Rpa1replication protein A1106214041962191518Rat
1307381Jmjd8jumonji domain containing 8101519595415198870Rat
1307720Socs7suppressor of cytokine signaling 7108530179785337971Rat
1307767Mfsd6lmajor facilitator superfamily domain containing 6-like105513863355140726Rat
1307773Pgpphosphoglycolate phosphatase101383610513838731Rat
1310607Rpl26ribosomal protein L26105549241755495547Rat
3772Stat3signal transducer and activator of transcription 3108879040188842263Rat
3830Hnf1bHNF1 homeobox B107115986371218902Rat
619860Dynll2dynein light chain LC8-type 2107526253675281302Rat
1306564Srlsarcalumenin101124013511284325Rat
1307369Smyd4SET and MYND domain containing 4106219166962237939Rat
1307423Tmem97transmembrane protein 97106581145565820538Rat
1305894Tcf7transcription factor 7103761603337646027Rat
1305028Ezh1enhancer of zeste 1 polycomb repressive complex 2 subunit108910402689139978Rat
1306638Sgcdsarcoglycan, delta103206294632471454Rat
1307488Cntrobcentrobin, centriole duplication and spindle assembly protein105590192955927121Rat
1307490Rundc1RUN domain containing 1108933900389349230Rat
1306689Mllt6MLLT6, PHD finger containing108560798885628171Rat
1306692Serpinf2serpin family F member 2106226424762272353Rat
1305360Acap1ArfGAP with coiled-coil, ankyrin repeat and PH domains 1105649230056506446Rat
1305361Wfikkn2WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2108193615681943142Rat
1307740Natd1N-acetyltransferase domain containing 1104715444347164622Rat
1307741Scrn2secernin 2108496686284971022Rat
620162Fgf11fibroblast growth factor 11105640332056410816Rat
1305385Hrobhomologous recombination factor with OB-fold109019260890214486Rat
1305161Atpaf2ATP synthase mitochondrial F1 complex assembly factor 2104676853946783889Rat
1304758Tmub2transmembrane and ubiquitin-like domain containing 2109023042890234874Rat
1306595Tefmtranscription elongation factor, mitochondrial106747600667478830Rat
1307203Nudcd2NudC domain containing 2102589094325896432Rat
3183Nognoggin107681175976813386Rat
1307032Linc00514long intergenic non-protein coding RNA 514101304107413053416Rat
1307040Map2k4mitogen activated protein kinase kinase 4105219612152301887Rat
1306768Sp6Sp6 transcription factor108495075184961368Rat
1305252Rnf135ring finger protein 135106753198967551237Rat
1305871Tnfsf13TNF superfamily member 13105628696456290680Rat
61920Slc13a2solute carrier family 13 member 2106566466565692046Rat
70497Nme1NME/NM23 nucleoside diphosphate kinase 1108165715281666542Rat
1305731Phf12PHD finger protein 12106481546264863514Rat
1306000Iba57iron-sulfur cluster assembly factor IBA57104550612445514909Rat
1305362Fam114a2family with sequence similarity 114, member A2104289357942933041Rat
1307186Jmjd4jumonji domain containing 4104579896445804188Rat
1303290Klhl10kelch-like family member 10108835665288372929Rat
1304803Wdr24WD repeat domain 24101519107815195860Rat
1304805Krt12keratin 12108732854787336710Rat
708425Havcr1hepatitis A virus cellular receptor 1103181381931860934Rat
620258Rcvrnrecoverin105424625054253996Rat
68942Cacna1gcalcium voltage-gated channel subunit alpha1 G108212907182197828Rat
1305522B9d1B9 domain containing 1104778429447794399Rat
1307125Kctd11potassium channel tetramerization domain containing 11105648955256491715Rat
1307222Cluhclustered mitochondria homolog106143287261454445Rat
1307227Fstl4follistatin-like 4103810434438532216Rat
1306308Eif1eukaryotic translation initiation factor 1108822745588229546Rat
1333911Olr1448olfactory receptor 1448104463218844633106Rat
1332774Olr1449olfactory receptor 1449104465057044651490Rat
1332779Olr1403-psolfactory receptor pseudogene 1403103645664336457198Rat
1311493Atxn7l3ataxin 7-like 3109023474990241757Rat
1333938Olr1434olfactory receptor 1434104433089744331817Rat
1308631Maml1mastermind-like transcriptional coactivator 1103576519635801375Rat
1308636Rnf187ring finger protein 187104527340045279299Rat
1309277Mrpl22mitochondrial ribosomal protein L22104360178643612119Rat
1305330Alox12barachidonate 12-lipoxygenase, 12R type105574464655756524Rat
1309441Lsm12LSM12 homolog109010556290127600Rat
1333284Olr1390-psolfactory receptor pseudogene 1390103459267434593611Rat
1308329Wwc1WW and C2 domain containing 1102066299620818500Rat
1310172Ctdnep1CTD nuclear envelope phosphatase 1105659082256600235Rat
1308683MntMAX network transcriptional repressor106168377661700504Rat
1333640Olr1417olfactory receptor 1417104399760443998533Rat
1333644Olr1485olfactory receptor 1485106026679760275768Rat
1333651Olr1420-psolfactory receptor pseudogene 1420104406096344061926Rat
1333402Olr1387olfactory receptor 1387103455328434554219Rat
1309906AdprmADP-ribose/CDP-alcohol diphosphatase, manganese-dependent105358327553595821Rat
1333419Olr1393olfactory receptor 1393103466218634663121Rat
1333422Olr1418olfactory receptor 1418104402525144029865Rat
1311042Fmnl1formin-like 1109125375791281422Rat
1308404Acbd4acyl-CoA binding domain containing 4109118613191200081Rat
1309090Mrpl27mitochondrial ribosomal protein L27108237557282381332Rat
1310880Prss22serine protease 22101337009813374808Rat
1311987Pld6phospholipase D family, member 6104614231346145774Rat
1333495Olr1447-psolfactory receptor pseudogene 1447104460661144607505Rat
1333497Olr1354-psolfactory receptor pseudogene 1354101228047012281171Rat
1333892Olr1517olfactory receptor 1517106108788061088827Rat
1308942Gjd3gap junction protein, delta 3108688898286891915Rat
1308943Vat1vesicle amine transport 1108936689889374516Rat
1308952Rab11fip3RAB11 family interacting protein 3101534835615433384Rat
1307274Sdf2stromal cell derived factor 2106550736465517839Rat
1309742Arhgap23Rho GTPase activating protein 23108538721985445805Rat
1309749Trim16tripartite motif-containing 16104923166049254653Rat
1332930Olr1520olfactory receptor 1520106115237961153267Rat
1309718Specc1sperm antigen with calponin homology and coiled-coil domains 1104824029148542171Rat
1310402Tns4tensin 4108697750487001256Rat
1308645Slfn2schlafen family member 2107037038170376718Rat
1332835Olr1436olfactory receptor 1436104487670644877626Rat
1332843Olr1409olfactory receptor 1409103653071936531660Rat
1332844Olr1492olfactory receptor 1492106042781760428755Rat
1332668Olr1489-psolfactory receptor pseudogene 1489106037911960379279Rat
1310180Lmf1lipase maturation factor 1101494518515031855Rat
1309650Efcab5EF-hand calcium binding domain 5106297064563086704Rat
1333378Olr1476-psolfactory receptor pseudogene 1476106017268660173190Rat
1333960Olr1364olfactory receptor 1364101238526012386222Rat
1333197Olr1377-psolfactory receptor pseudogene 1377101270974912710645Rat
1560459Gltpd2glycolipid transfer protein domain containing 2105712612757127783Rat
1333517Olr1488olfactory receptor 1488106036358860364526Rat
1308105Ksr1kinase suppressor of ras 1106634610066482396Rat
1308105Ksr1kinase suppressor of ras 1106632370466342469Rat
1308025Slc35g3solute carrier family 35, member G3105636657856368360Rat
1308029Eif5aeukaryotic translation initiation factor 5A105652707556531615Rat
1309576Tmem220transmembrane protein 220105357098053579994Rat
1333146Olr1511olfactory receptor 1511106097422560975172Rat
1333149Olr1382olfactory receptor 1382101281719612818137Rat
1333212Olr1375olfactory receptor 1375101264335112644292Rat
1333061Olr1421olfactory receptor 1421104408135144082313Rat
1333064Olr1523olfactory receptor 1523107520156375202077Rat
1333296Olr1483-psolfactory receptor pseudogene 1483106025064260251586Rat
1559818Tp53i13tumor protein p53 inducible protein 13106265064062655327Rat
1359364Hba-a2hemoglobin alpha, adult chain 2101558936415590207Rat
1359189Cluap1clusterin associated protein 1101184705811878792Rat
1359195Tlcd1TLC domain containing 1106543910465441140Rat
1309585Sap30lSAP30-like104322415143231864Rat
1310360Kif18bkinesin family member 18B109100829491027760Rat
1309141Osbpl7oxysterol binding protein-like 7108498633085003947Rat
1309150Drc3dynein regulatory complex subunit 3104671202146762276Rat
1309152Jade2jade family PHD finger 2103726913237315638Rat
1333898Olr1435olfactory receptor 1435104434787844348795Rat
1333926Olr1380olfactory receptor 1380101277630412777245Rat
1333927Olr1400olfactory receptor 1400103477171534772570Rat
1333085Olr1461olfactory receptor 1461104515934245160268Rat
1333088Olr1486olfactory receptor 1486106030836860309306Rat
1311929Ccdc43coiled-coil domain containing 43109064499390658241Rat
1359411Krt31keratin 31108795912387962891Rat
1334164Olr1432olfactory receptor 1432104425597444256945Rat
1334167Olr1445olfactory receptor 1445104456861544569535Rat
1309875Lig3DNA ligase 3107013473470158051Rat
1333178Olr1504olfactory receptor 1504106077137560772313Rat
1332670Olr1425olfactory receptor 1425104415638344157330Rat
1332671Olr1373olfactory receptor 1373101260238812603329Rat
1333581Olr1358olfactory receptor 1358101210013312103463Rat
1333585Olr1499olfactory receptor 1499106057219460573129Rat
1333590Olr1470olfactory receptor 1470105998391859984862Rat
1334004Olr1477-psolfactory receptor pseudogene 1477106032644160327671Rat
1332943Olr1442olfactory receptor 1442104452746844528382Rat
1332945Olr1440olfactory receptor 1440104497144744972367Rat
1332948Olr1458olfactory receptor 1458104477428044775206Rat
1311905Prss32protease, serine, 32101319670013202783Rat
1334234Olr1444-psolfactory receptor pseudogene 1444104455278644552983Rat
1334237Olr1512olfactory receptor 1512106099752560998472Rat
1333952Olr1481olfactory receptor 1481106000509060006037Rat
1332685Olr1513olfactory receptor 1513106103311361034051Rat
1332688Olr1424olfactory receptor 1424104414577844149990Rat
1308314Nlrp3NLR family, pyrin domain containing 3104588432445918290Rat
1311549Rasgef1cRasGEF domain family, member 1C103539276235459267Rat
2157Arrb2arrestin, beta 2105704025257048045Rat
1312011Shmt1serine hydroxymethyltransferase 1104703081347059216Rat
1308349Trim37tripartite motif-containing 37107443616574568636Rat
1308356N4bp3Nedd4 binding protein 3103499670235005365Rat
1308357Tfap4transcription factor AP-4101120461611222975Rat
1311296Camta2calmodulin binding transcription activator 2105729119257309638Rat
1559720Cisd3CDGSH iron sulfur domain 3108562857985631656Rat
1306875Arl4dADP-ribosylation factor like GTPase 4D108957755689580368Rat
1306884GrapGRB2-related adaptor protein104793063347949774Rat
1307629Kdm6blysine demethylase 6B105600049456009582Rat
1332603Olr1416olfactory receptor 1416104394656543947494Rat
1332786Olr1378olfactory receptor 1378101273095912731897Rat
1333627Olr1495-psolfactory receptor pseudogene 1495106049685560497491Rat
1333630Olr1372olfactory receptor 1372101256671412571316Rat
1310429RGD1310429similar to Protein Njmu-R1106773813167751049Rat
1310432Rdm1RAD52 motif containing 1108954033389550496Rat
1333100Olr1388olfactory receptor 1388103456400934564944Rat
1560577Ormdl3ORMDL sphingolipid biosynthesis regulator 3108654591086554478Rat
1334020Olr1419-psolfactory receptor pseudogene 1419104403996344040906Rat
1359152Ccl7C-C motif chemokine ligand 7106942308369424933Rat
1332615Olr1422olfactory receptor 1422104409483144095775Rat
1310862CrebrfCREB3 regulatory factor101669384616753162Rat
1311365Trappc1trafficking protein particle complex 1105592499655926582Rat
1310708Fndc8fibronectin type III domain containing 8107024285270250990Rat
1310714Cbx1chromobox 1108465669884677112Rat
1310716Ccr10C-C motif chemokine receptor 10108908655689088993Rat
1310723Dhx8DEAH-box helicase 8108964597989683839Rat
1311859Odad4outer dynein arm docking complex subunit 4108845949088488237Rat
1310873Rasl10bRAS-like, family 10, member B107062622770639072Rat
1332828Olr1487-psolfactory receptor pseudogene 1487106035215460353094Rat
1310181Ulk2unc-51 like autophagy activating kinase 2104805007948129377Rat
1310324Zswim7zinc finger, SWIM-type containing 7104858711748599208Rat
1310333Itga3integrin subunit alpha 3108285584182887755Rat
1311882Epxeosinophil peroxidase107516069075171774Rat
1311464Fbxo39F-box protein 39105887402858878445Rat
1311470Psmd3proteasome 26S subunit, non-ATPase 3108659900786611180Rat
1359186Olr1469olfactory receptor Olr1469105997274259973686Rat
1359209Hba-a3hemoglobin alpha, adult chain 3101557724915577977Rat
1359211Dcakddephospho-CoA kinase domain containing109109560191126733Rat
1311972Nfe2l1nuclear factor, erythroid 2-like 1108468676284699313Rat
1333322Olr1363-psolfactory receptor pseudogene 1363101238195112382613Rat
1333324Olr1427-psolfactory receptor pseudogene 1427104418035944180656Rat
1310922Snrnp25small nuclear ribonucleoprotein U11/U12 subunit 25101568599915689338Rat
1309725Dvl2dishevelled segment polarity protein 2105660981056619269Rat
1310780Hoxb3homeo box B3108417062984196823Rat
1310782Ndufb10NADH:ubiquinone oxidoreductase subunit B10101409012814092289Rat
1310783Cnot6CCR4-NOT transcription complex, subunit 6103514429135195126Rat
1332601Olr1522olfactory receptor 1522107519067375191608Rat
1311289Spag9sperm associated antigen 9108169373681827562Rat
1311564Ypel2yippee-like 2107424103274298691Rat
1311573Mmp28matrix metallopeptidase 28107066069170681672Rat
1310745Zscan10zinc finger and SCAN domain containing 10101292947112939439Rat
1333915Olr1508-psolfactory receptor pseudogene 1508106092941660930362Rat
1311343RGD1311343similar to RIKEN cDNA 4930524B15101594725315960728Rat
1311347Pipoxpipecolic acid and sarcosine oxidase106495198664964865Rat
1311967Tubd1tubulin, delta 1107386582873886976Rat
1333571Olr1394olfactory receptor 1394103467272634673655Rat
1332806Olr1401olfactory receptor 1401103480487834805813Rat
1332809Olr1460olfactory receptor 1460104480463144805557Rat
1309043Tmem106atransmembrane protein 106A108948426989493288Rat
1312040Senp3SUMO specific peptidase 3105627760956286867Rat
1560397Msi2musashi RNA-binding protein 2107567384076040106Rat
1359156Spata32spermatogenesis associated 32109129132091302344Rat
1333612Olr1490olfactory receptor 1490106039161460392552Rat
1333616Olr1497-psolfactory receptor pseudogene 1497106053612360537060Rat
1332851Olr1474olfactory receptor 1474106012576460126702Rat
1310473Chtf18chromosome transmission fidelity factor 18101509076215098825Rat
1332756Olr1475olfactory receptor 1475106015102960151967Rat
1332757Olr1496olfactory receptor 1496106239274162393673Rat
1308999Cldn9claudin 9101300301013004441Rat
1311635Hexim2HEXIM P-TEFb complex subunit 2109121229691222841Rat
1309121Fbxw11F-box and WD repeat domain containing 11101754237417640718Rat
1309122Hspb9heat shock protein family B (small) member 9108862065588621300Rat
1308665Nprl3NPR3-like, GATOR1 complex subunit101562082415661332Rat
1333990Olr1452olfactory receptor 1452104471421244715201Rat
1309561Rnf145ring finger protein 145103016914730207505Rat
1309435Nhp2NHP2 ribonucleoprotein103497570134979082Rat
1560689RGD1560689similar to Proteasome subunit beta type 3 (Proteasome theta chain)103732166737323733Rat
1560541Tmem100transmembrane protein 100107753734077543710Rat
1305664Arhgap44Rho GTPase activating protein 44105150154751669546Rat
1305666Unc45bunc-45 myosin chaperone B107026234070290445Rat
1306907Higd1bHIG1 hypoxia inducible domain family, member 1B109092936290931639Rat
1306908Spdl1spindle apparatus coiled-coil protein 1101962807019652914Rat
1310147Tbc1d9bTBC1 domain family member 9B103563710335677335Rat
1310903Plcd3phospholipase C, delta 3109116477891186067Rat
1309472Slc46a1solute carrier family 46 member 1106572850865741708Rat
1332794Olr1411olfactory receptor 1411103656720036568132Rat
1332797Olr1438-psolfactory receptor pseudogene 1438104494636144947270Rat
1307699Mpdu1mannose-P-dolichol utilization defect 1105626163656267213Rat
1306167Stub1STIP1 homology and U-box containing protein 1101519775415200035Rat
1306172Rnd2Rho family GTPase 2108937653089380101Rat
1309215Rars1arginyl-tRNA synthetase 1102063363020658074Rat
1309457Med31mediator complex subunit 31105878098758784369Rat
1309380Tnip1TNFAIP3 interacting protein 1104025577640303092Rat
1309385Flywch1FLYWCH-type zinc finger 1101308792513107833Rat
1309255Ccl12chemokine (C-C motif) ligand 12106947686669478416Rat
1308466Ctnscystinosin, lysosomal cystine transporter105974925059772475Rat
1306514Capn15calpain 15101531977215346607Rat
1306524Etv4ETS variant transcription factor 4108968505889700300Rat
1306862Smg8SMG8 nonsense mediated mRNA decay factor107437922474388838Rat
1305232Slc5a10solute carrier family 5 member 10104794977547997802Rat
1305233Havcr2hepatitis A virus cellular receptor 2103156183831590624Rat
1305448Trim11tripartite motif-containing 11104532219945335030Rat
1309957Utp18UTP18 small subunit processome component108156092981588156Rat
1309959Tada2atranscriptional adaptor 2A107139370171441435Rat
1308590MlxMAX dimerization protein MLX108899701189002154Rat
1309926Sh3pxd2bSH3 and PX domains 2B101720915217296449Rat
1333969Olr1463olfactory receptor 1463104593917845940137Rat
1308010Plekhm1pleckstrin homology and RUN domain containing M1109145189091500675Rat
1305792Krt36keratin 36108801660288019967Rat
1306484RGD1306484similar to growth and transformation-dependent protein103758267837583232Rat
1307542Luc7lLUC7-like101553887815572651Rat
1309389Ssh2slingshot protein phosphatase 2106270228662954907Rat
1307301Zfp263zinc finger protein 263101202367712035189Rat
1307084Ska2spindle and kinetochore associated complex subunit 2107441398974431922Rat
1308298Mmp25matrix metallopeptidase 25101296221412966377Rat
1308301Nle1notchless homolog 1107025095970261880Rat
1306222Metrnmeteorin, glial cell differentiation regulator101516443915166457Rat
1309289Nthl1nth-like DNA glycosylase 1101399666014002827Rat
1309290Supt6hSPT6 homolog, histone chaperone and transcription elongation factor106547047065507581Rat
1309302Rnf151ring finger protein 151101408353814088011Rat
1309400Ift20intraflagellar transport 20106580580865811353Rat
1310093Dhx58DEXH-box helicase 58108859972288611562Rat
1309496Alkbh5alkB homolog 5, RNA demethylase104690631446927759Rat
1308134RGD1308134similar to RIKEN cDNA 1110020A23105684384656848265Rat
1309092Slc36a3solute carrier family 36, member 3104046275240490259Rat
1305460Ppm1dprotein phosphatase, Mg2+/Mn2+ dependent, 1D107290955072945884Rat
1308696Cdkn2aipnlCDKN2A interacting protein N-terminal like103742264737432082Rat
1310602RGD1310602similar to hypothetical protein MGC15396105785205657853248Rat
1306957Sgsm2small G protein signaling modulator 2106170383761745110Rat
1306961Arhgef15Rho guanine nucleotide exchange factor 15105553209755545675Rat
1306963Mrps23mitochondrial ribosomal protein S23107552726575536767Rat
1306968Lyzl6lysozyme-like 6109169454791701428Rat
1307639Trarg1trafficking regulator of GLUT4 (SLC2A4) 1106347133063491713Rat
1305970Cd68Cd68 molecule105626872656270605Rat
1305972Rnf167ring finger protein 167105726833157272667Rat
1306667Prss34protease, serine, 34101465681214658569Rat
1306673Klhl11kelch-like family member 11108837869588389252Rat
1310963Nlrp1aNLR family, pyrin domain containing 1A105769247457747608Rat
1332804Olr1515olfactory receptor 1515106242751762428488Rat
1310936Spsb3splA/ryanodine receptor domain and SOCS box containing 3101424819914253815Rat
1310113Tnk1tyrosine kinase, non-receptor, 1105645865056475183Rat
1308200Pitpnm3PITPNM family member 3105861867958722679Rat
1310563Ccl9chemokine (C-C motif) ligand 9107078342670788372Rat
1307835Wsb1WD repeat and SOCS box-containing 1106658690566602984Rat
1307841Mfap4microfibril associated protein 4104776546347768484Rat
1308139Ncbp3nuclear cap binding subunit 3105961339859643111Rat
1308149Zcchc10zinc finger CCHC-type containing 10103866402038674419Rat
1308151Cfap52cilia and flagella associated protein 52105447083454512157Rat
1305300Krt35keratin 35108800617988009576Rat
1308161Mrpl55mitochondrial ribosomal protein L55104555279445555943Rat
708568Rabep1rabaptin, RAB GTPase binding effector protein 1105746227257579901Rat
1306682Mien1migration and invasion enhancer 1108639184886393141Rat
1306683Larp1La ribonucleoprotein 1, translational regulator104343573843501186Rat
1306684Spaca3sperm acrosome associated 3106822773668235295Rat
1305891Pwwp2aPWWP domain containing 2A102928806029335425Rat
1306620Map2k3mitogen activated protein kinase kinase 3104508945545110802Rat
1306252Aloxe3arachidonate lipoxygenase 3105571199655735915Rat
1308042Haghlhydroxyacylglutathione hydrolase-like101515273615157221Rat
1308744Dlx4distal-less homeobox 4108295852582963919Rat
1308747PimregPICALM interacting mitotic regulator105861358858618524Rat
1309622Nt5m5',3'-nucleotidase, mitochondrial104621649446244478Rat
1306488Appbp2amyloid beta precursor protein binding protein 2107250334772545141Rat
1306490Tmem101transmembrane protein 101109009234390096096Rat
1308075Tekt4tektin 4101482864214833818Rat
1309177Glis2GLIS family zinc finger 2101115445911177063Rat
1309113Hoxb13homeo box B13108403195584034228Rat
1332862Olr1366olfactory receptor 1366101246595112477715Rat
1309157Cdc6cell division cycle 6108681947786833301Rat
1310078Sarm1sterile alpha and TIR motif containing 1106574234365766050Rat
1308264Tbx21T-box transcription factor 21108503279985049331Rat
1307155Mettl26methyltransferase like 26101523975315255054Rat
1307174Abca3ATP binding cassette subfamily A member 3101372336513780558Rat
1307184Zbtb4zinc finger and BTB domain containing 4105636758656388296Rat
1309330Scarf1scavenger receptor class F, member 1106366296763683916Rat
1332690Olr1450olfactory receptor 1450104467983244680749Rat
1309057Tbx4T-box transcription factor 4107333186473362784Rat
1311613Spopspeckle type BTB/POZ protein108323118783311987Rat
1311614GnptgN-acetylglucosamine-1-phosphate transferase subunit gamma101459305014597995Rat
1311618ItkIL2-inducible T-cell kinase103143182031493413Rat
1307095Rab5cRAB5C, member RAS oncogene family108862192488645364Rat
1310239Gp1baglycoprotein Ib platelet subunit alpha105726068057263546Rat
1308004Shpksedoheptulokinase105976532859789676Rat
1307851FAM187Afamily with sequence similarity 187, member A109098873290990203Rat
1308709Tm4sf5transmembrane 4 L six family member 5105711190757118299Rat
1310163Srrm2serine/arginine repetitive matrix 2101312882013162956Rat
1310166RGD1310166similar to Chromodomain-helicase-DNA-binding protein 1 (CHD-1)107248602372497052Rat
1309638Guk1guanylate kinase 1104553561745552455Rat
1305467Prpf8pre-mRNA processing factor 8106363523963658360Rat
1306182Phospho1phosphoethanolamine/phosphocholine phosphatase 1108363555783643862Rat
1309863Nsrp1nuclear speckle splicing regulatory protein 1106309811563131779Rat
1310306Mtmr4myotubularin related protein 4107488660074909532Rat
1306625Smim23small integral membrane protein 23101771759917721233Rat
1306633Zfp39zinc finger protein 39104522035245243653Rat
1309231Emc6ER membrane protein complex subunit 6105974177259743338Rat
1308837Cldn6claudin 6101299925613002860Rat
1308838Krt23keratin 23108739162387407634Rat
1308781Septin4septin 4107486006874884196Rat
1310298Hoxb1homeo box B1108421435884215812Rat
1310274Clk4CDC-like kinase 4103671556536733473Rat
1306944Rad51dRAD51 paralog D107022270370241352Rat
1306948Copz2COPI coat complex subunit zeta 2108471882484731880Rat
1307642Alox12earachidonate 12-lipoxygenase, epidermal105692767656935141Rat
1307645Rapgef6Rap guanine nucleotide exchange factor 6103987532240039929Rat
1307659Brip1BRCA1 interacting protein C-terminal helicase 1107350700973632742Rat
1309320Top3aDNA topoisomerase III alpha104698064647018728Rat
1309845Zmynd15zinc finger, MYND-type containing 15105706448257071096Rat
1332679Olr1412-psolfactory receptor pseudogene 1412103657728836577774Rat
1311391Vps53VPS53 subunit of GARP complex106421859664341064Rat
1311395Pgap6post-glycosylphosphatidylinositol attachment to proteins 6101548495215495380Rat
1332706Olr1433olfactory receptor 1433104429292744293954Rat
1332708Olr1437olfactory receptor 1437104440747544408395Rat
1308347Ube2zubiquitin-conjugating enzyme E2Z108386970383888823Rat
1308449Septin8septin 8103887742238906480Rat
1306138Samd14sterile alpha motif domain containing 14108282045782838046Rat
1309451Sec24aSEC24 homolog A, COPII coat complex component103713853937215899Rat
1309452Nipal4NIPA-like domain containing 4103124139431258105Rat
1310531Pank3pantothenate kinase 3102059143220615258Rat
1308056Neurl4neuralized E3 ubiquitin protein ligase 4105651186156524233Rat
1308057Wnt3aWnt family member 3A104559889845643151Rat
1308058Vezf1vascular endothelial zinc finger 1107536576375382014Rat
1308062Sgcasarcoglycan, alpha108277090582785142Rat
1308212Wscd1WSC domain containing 1105833071158372966Rat
1333440Olr1396olfactory receptor 1396103471287034713805Rat
1332858Olr1480-psolfactory receptor pseudogene 1480106019903860199978Rat
1308868Txndc17thioredoxin domain containing 17105877679258779764Rat
1308869Akap10A-kinase anchoring protein 10104815090248210074Rat
1308881GhdcGH3 domain containing108867283488677055Rat
1308885Trim41tripartite motif-containing 41103415551534166599Rat
1308911Meox1mesenchyme homeobox 1108979701189817009Rat
1308915Naa60N(alpha)-acetyltransferase 60, NatF catalytic subunit101188163511902139Rat
1308924Tax1bp3Tax1 binding protein 3105974335659748063Rat
1308617Zfp287zinc finger protein 287104913176449150930Rat
1307929RGD1307929similar to CG14967-PA106552314365552629Rat
1307935Dhrs11dehydrogenase/reductase 11107214404272153496Rat
1332792Olr1389olfactory receptor 1389103457835634579291Rat
1332793Olr1525olfactory receptor 1525101228377512284736Rat
1305982Ciao3cytosolic iron-sulfur assembly component 3101514373215152706Rat
1307903Stxbp4syntaxin binding protein 4107800574578168641Rat
1310354Usp22ubiquitin specific peptidase 22104742920147453298Rat
1310573Rnf222ring finger protein 222105547279455484850Rat
1310582Tekt3tektin 3104947252049506473Rat
1309673P4ha2prolyl 4-hydroxylase subunit alpha 2103943522739464134Rat
1310352RGD1310352similar to HTGN29 protein; keratinocytes associated transmembrane protein 2103775713137769781Rat
1308492RpainRPA interacting protein105760628757613834Rat
1308500Rai1retinoic acid induced 1104651127146571591Rat
1309595Taf15TATA-box binding protein associated factor 15107068986370721892Rat
1309598Ankfy1ankyrin repeat and FYVE domain containing 1105925995559331669Rat
1309530Krt28keratin 28108727609487286753Rat
1309533Paqr4progestin and adipoQ receptor family member 4101307225213075866Rat
1306143Tbc1d24TBC1 domain family, member 24101355110013576739Rat
1306158Hoxb9homeo box B9108411977284124963Rat
1309817Tmem11transmembrane protein 11104711713347131842Rat
1305506Ubtd2ubiquitin domain containing 2101732725017392431Rat
1305508Dhrs13dehydrogenase/reductase 13106532940765334533Rat
1310144Snf8SNF8 subunit of ESCRT-II108385633183868621Rat
1306193Slc25a39solute carrier family 25, member 39109035189990356905Rat
1310051Lpolactoperoxidase107510038575120247Rat
1333245Olr1415olfactory receptor 1415104393008743931094Rat
1333251Olr1355olfactory receptor 1355101231173012312692Rat
1333252Olr1503-psolfactory receptor pseudogene 1503106076426460764724Rat
1333253Olr1501olfactory receptor 1501106072816060729095Rat
1307486Hbzhemoglobin subunit zeta101560934815610826Rat
1307868Gas2l2growth arrest-specific 2 like 2107063942970646402Rat
1307869Sat2spermidine/spermine N1-acetyltransferase family member 2105622770356229796Rat
1310386Ublcp1ubiquitin-like domain containing CTD phosphatase 1103010360730118945Rat
1308066Shroom1shroom family member 1103881442038825159Rat
1562292Hoxb5homeo box B5108415215284154360Rat
1564189Dock2dedicator of cytokinesis 2101918151219603171Rat
1564190Tlx3T-cell leukemia, homeobox 3101812886918131745Rat
1561384Ccnjlcyclin J-like102912271329181610Rat
1563438Tmem256transmembrane protein 256105644602256447138Rat
1560464RGD1560464similar to hypothetical protein FLJ38426103431677634318634Rat
1560494Abca17ATP-binding cassette, subfamily A (ABC1), member 17101363007613723155Rat
1563668RGD1563668similar to High mobility group protein 1 (HMG-1)104099423740994990Rat
1563746Meiocmeiosis specific with coiled-coil domain109062295490641883Rat
1334376Olr1356olfactory receptor 1356101194194711942885Rat
1563656RGD1563656similar to 40S ribosomal protein S2101287100312871735Rat
1563944Nsg2neuronal vesicle trafficking associated 2101586788515928169Rat
1560444RGD1560444similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12)104515519945156311Rat
1563691Mapk8ip3mitogen-activated protein kinase 8 interacting protein 3101425939414299276Rat
1562012Lyrm9LYR motif containing 9106609947866113559Rat
1333783Olr1521olfactory receptor 1521107518657275187507Rat
1333058Olr1507olfactory receptor 1507106086452260865466Rat
1559538Sco1synthesis of cytochrome C oxidase 1105359585453608437Rat
1566425Tmem199transmembrane protein 199106577572165780293Rat
1563885Borcs6BLOC-1 related complex subunit 6105564207055643924Rat
1563889Fbxw10F-box and WD repeat domain containing 10104925905049296714Rat
1559753Lrrc37aleucine rich repeat containing 37A109154870491581537Rat
1563715Gemin4gem (nuclear organelle) associated protein 4106436480864375885Rat
1563924Cdc42se2CDC42 small effector 2104005439340122915Rat
1565061Spem2SPEM family member 2105642416456426012Rat
1559732Btnl10butyrophilin like 10104525794645266233Rat
1561932Fam183afamily with sequence similarity 183 member A104473654744746907Rat
1565925Ccdc42coiled-coil domain containing 42105516931255179489Rat
1303256Prss27serine protease 27101341089913418260Rat
1560244Ccdc78coiled-coil domain containing 78101515583915160039Rat
1564618Shisa6shisa family member 6105274406953037853Rat
1561950Zfp286azinc finger protein 286A104918590649196765Rat
1563963RGD1563963similar to Phosphoglycerate mutase 1 (Phosphoglycerate mutase isozyme B)105329918553330755Rat
1564984Neurl1bneuralized E3 ubiquitin protein ligase 1B101704825117075139Rat
1334353Olr1386olfactory receptor 1386103438043834384343Rat
1359595Krt33bkeratin 33B109079325490797418Rat
1562350Uqcrqubiquinol-cytochrome c reductase, complex III subunit VII103877913238782489Rat
1311234Bhlha9basic helix-loop-helix family, member a9106349826763500353Rat
1564516Timd4T-cell immunoglobulin and mucin domain containing 4103188082231917215Rat
1562746Gps2G protein pathway suppressor 2105652432756527447Rat
1565087Dnah2dynein, axonemal, heavy chain 2105602902256154602Rat
1564031RGD1564031similar to transcription elongation factor B (SIII), polypeptide 2107629538776297007Rat
1564036MrnipMRN complex interacting protein103568068735704685Rat
1564337Coa3cytochrome C oxidase assembly factor 3108919875089199731Rat
1562712Gjc2gap junction protein, gamma 2104552674045535520Rat
1311243Dhrs7bdehydrogenase/reductase 7B104706575547111089Rat
1311922Ttll6tubulin tyrosine ligase like 6108395422183999542Rat
1311923Chd3chromodomain helicase DNA binding protein 3105594346755970417Rat
1563179Bcl6bBCL6B, transcription repressor105683436356840058Rat
1563195RangrfRAN guanine nucleotide release factor105555904955560420Rat
1359648Skp1S-phase kinase-associated protein 1103759457837609498Rat
1334321Olr1404olfactory receptor 1404103646622936467176Rat
1334326Olr1456olfactory receptor 1456104473035444731346Rat
1561157RGD1561157RGD1561157101308430413085228Rat
1564005Ankrd13bankyrin repeat domain 13B106267441662691949Rat
1560850Pik3r6phosphoinositide-3-kinase, regulatory subunit 6105508526955135069Rat
1359691Rflnbrefilin B106419610364202380Rat
1359701Krt32keratin 32108799356988000818Rat
1565744Tsr3TSR3 ribosome maturation factor101459801414600576Rat
1560033Gpr179G protein-coupled receptor 179108527383985289886Rat
1561590RGD1561590similar to SAP18108963565189636271Rat
1561674LOC497899similar to hypothetical protein 4930503F14103670901836717989Rat
1561684RGD1561684similar to keratin associated protein 2-4108754106087541842Rat
1562656Acsf2acyl-CoA synthetase family member 2108228471982326771Rat
1565729Prss38serine protease 38104572366345731756Rat
1563261Pik3r5phosphoinositide-3-kinase, regulatory subunit 5105501368655078986Rat
1560789RGD1560789similar to ribosomal protein S2101571446915715270Rat
1563765Rad51cRAD51 paralog C107469771374724004Rat
1561277RGD1561277RGD1561277104516938145185463Rat
1564452Magmas-ps1mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction, pseudogene 1109175286091753380Rat
1561781Tmem88transmembrane protein 88105599853056000225Rat
1561041C1qtnf2C1q and TNF related 2102906710229084035Rat
1561050RGD1561050similar to Eno1 protein105315046753151468Rat
1559918Hoxb7homeo box B7108413522484138642Rat
1311014Tbx2T-box transcription factor 2107327893273290764Rat
1311017Utp6UTP6 small subunit processome component106725517767285754Rat
1560049Dusp3dual specificity phosphatase 3108990457889918296Rat
1359620Tnfsf12TNF superfamily member 12105629078056300137Rat
1311694Aff4AF4/FMR2 family, member 4103869216738773021Rat
1334152Olr1391olfactory receptor 1391103463139834632327Rat
1334155Olr1459olfactory receptor 1459104478921744790143Rat
1334158Olr1510-psolfactory receptor pseudogene 1510106095642260957361Rat
1561796RGD1561796RGD1561796101187804311880822Rat
1562694Dph1diphthamide biosynthesis 1106201937962032384Rat
1562698Myo18amyosin XVIIIa106497977065080535Rat
1332722Olr1392olfactory receptor 1392103464537534646310Rat
1561873Myo15amyosin XVA104684009846897362Rat
1561884Spns3sphingolipid transporter 3105905646059113310Rat
1359314Tmem204transmembrane protein 204101441760814446272Rat
1308121Zfp207zinc finger protein 207106776297067784854Rat
1309127Fbxl16F-box and leucine-rich repeat protein 16101517648915188729Rat
1310487Map3k14mitogen-activated protein kinase kinase kinase 14109130342891353601Rat
1310489Nxnnucleoredoxin106441171064550147Rat
1334253Olr1505olfactory receptor 1505106081153460812601Rat
1334258Olr1405olfactory receptor 1405103647769236478615Rat
1334113Olr1374olfactory receptor 1374101262817312629114Rat
1559450Tmem102transmembrane protein 102105641089856413154Rat
1559567Cyb5d1cytochrome b5 domain containing 1105599320655997429Rat
1559575RGD1559575similar to novel protein103423257134256396Rat
620002Cdk5rap3CDK5 regulatory subunit associated protein 3108478064484789800Rat
1562411Rnft1ring finger protein, transmembrane 1107380745573821178Rat
1359513Thg1ltRNA-histidine guanylyltransferase 1-like103104364731052092Rat
1334265Olr1365olfactory receptor 1365101221388112215090Rat
1311813Gdpd1glycerophosphodiester phosphodiesterase domain containing 1107433497274376332Rat
1333777Olr1462olfactory receptor 1462104592171545924257Rat
1311931Cpeb4cytoplasmic polyadenylation element binding protein 4101598452016047209Rat
1359094Zfp672zinc finger protein 672104375269943768291Rat
1359097Krt25keratin 25108722536187238659Rat
1333308Olr1464-psolfactory receptor pseudogene 1464104596692645967993Rat
1559617Naa38N(alpha)-acetyltransferase 38, NatC auxiliary subunit105599761455998691Rat
1359092Krt10keratin 10108729644587301307Rat
1560914Dgkediacylglycerol kinase epsilon107637598176408224Rat
1562272RGD1562272similar to TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor107631230876314572Rat
1359139Slfn13schlafen family member 13107032615770343024Rat
1359145Krt40keratin 40108745362487459670Rat
1303157Krt24keratin 24108719018487195075Rat
1560728Mief2mitochondrial elongation factor 2104696953146975572Rat
1334012Olr1473-psolfactory receptor pseudogene 1473106007586160076629Rat
1334181Olr1498olfactory receptor 1498106054147260542410Rat
1563202Med11mediator complex subunit 11105705727257059415Rat
1564301RGD1564301similar to Hdac1 protein101970689419714499Rat
1333989Olr1466olfactory receptor 1466105991906459924512Rat
1312022Sox15SRY-box transcription factor 15105626051456263503Rat
1312025Slfn5schlafen family member 5107029809470312062Rat
1561080Wipf2WAS/WASL interacting protein family, member 2108677636786813046Rat
1562370Ccdc103coiled-coil domain containing 103109098421390987829Rat
1562380Drg2developmentally regulated GTP binding protein 2104681841246831308Rat
1562382Slc47a2solute carrier family 47 member 2104758790947631373Rat
1549701Olr1493olfactory receptor gene Olr1493106045504060455966Rat
1359332Odf4outer dense fiber of sperm tails 4105551033355516315Rat
1559851Hexim1HEXIM P-TEFb complex subunit 1109120087491202986Rat
1559861Vmo1vitelline membrane outer layer 1 homolog105712049957121584Rat
1359115Krt27keratin 27108725643487261717Rat
1359123MycbpapMycbp associated protein108223210582253649Rat
1359124Cyb5d2cytochrome b5 domain containing 2105934334759360979Rat
1359125Omgoligodendrocyte-myelin glycoprotein106684565466848388Rat
1359130Inpp5kinositol polyphosphate-5-phosphatase K106377563963796879Rat
1334078Olr1410olfactory receptor 1410103655439136555003Rat
1311260Mmgt2membrane magnesium transporter 2104898616348989596Rat
1333845Olr1519olfactory receptor 1519106116012561161060Rat
1333846Olr1408olfactory receptor 1408103651716936518110Rat
1334139Olr1397olfactory receptor 1397103470300134727869Rat
1333474Olr1484-psolfactory receptor pseudogene 1484106026679760266877Rat
1334013Olr1500olfactory receptor 1500106068463060685569Rat
1334088Olr1431olfactory receptor 1431104422880044229747Rat
1334096Olr1439olfactory receptor 1439104495854444959464Rat
1334190Olr1468olfactory receptor 1468105995693059957874Rat
631347Myocdmyocardin105168205351781458Rat
1562836Mgat4balpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B103572650135736338Rat
1562841Fbll1fibrillarin-like 1102062095720622600Rat
1561235Leap2liver-expressed antimicrobial peptide 2103877112538774515Rat
1563007LOC497940similar to RIKEN cDNA 2810408A11105650683456511716Rat
1559511Rmnd5brequired for meiotic nuclear division 5 homolog B103497990234990985Rat
1559512RGD1559512similar to tubulin, beta, 2103651968236521114Rat
1559662RGD1559662similar to implantation serine proteinase 2101468851814691097Rat
1334195Olr1509olfactory receptor 1509106094141660942351Rat
1549767CoasyCoenzyme A synthase108899241388996677Rat
1549768Stard3StAR-related lipid transfer domain containing 3108631343086335868Rat
1559653Traf7TNF receptor associated factor 7101387444413893090Rat
1559534RGD1559534similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase)104465863444662983Rat
1334074Olr1429-psolfactory receptor pseudogene 1429104420144844201802Rat
1311159Alox12arachidonate 12-lipoxygenase, 12S type105685173456864049Rat
1333878Olr1457olfactory receptor 1457104474953844750464Rat
1333886Olr1362olfactory receptor 1362101236971512370656Rat
1333596Olr1406olfactory receptor 1406103648560536486516Rat
1333600Olr1524-psolfactory receptor pseudogene 1524101230842412309125Rat
1310795Kremen2kringle containing transmembrane protein 2101307604213081210Rat
1309067Eme1essential meiotic structure-specific endonuclease 1108236682082375510Rat
1309072Sox8SRY-box transcription factor 8101493234814937336Rat
1309077Mrm3mitochondrial rRNA methyltransferase 3106439830864406193Rat
1311334Wdr81WD repeat domain 81106227381762287213Rat
1359526Ka11type I keratin KA11108814166788144624Rat
1333852Olr1454olfactory receptor 1454104471421244715201Rat
1333854Olr1491olfactory receptor 1491106040527160406209Rat
1561118RGD1561118similar to transcription elongation factor B (SIII), polypeptide 2107627444076284458Rat
1359229Nt5c3b5'-nucleotidase, cytosolic IIIB108833870088356538Rat
1334436Olr1514olfactory receptor 1514106104441161045355Rat
1559961Myo19myosin XIX107219847572227892Rat
1334083Olr1472olfactory receptor 1472106004384260044777Rat
1560383Krt222keratin 222108714320087154142Rat
1549726Zpbp2zona pellucida binding protein 2108651364586523375Rat
1333856Olr1407olfactory receptor 1407103649936136500284Rat
1333858Olr1395olfactory receptor 1395103469287034693799Rat
1332981Olr1471olfactory receptor 1471106002023060032218Rat
1334228Olr1467olfactory receptor 1467105993409959935052Rat
1562041Rnf130ring finger protein 130103553797635610711Rat
1549751Fkbp10FKBP prolyl isomerase 10108832633788338199Rat
1311123Slc47a1solute carrier family 47 member 1104763142547685379Rat
1311125Slc16a11solute carrier family 16, member 11105682269756826480Rat
1333716Olr1446-psolfactory receptor pseudogene 1446104459433144595246Rat
1332906Olr1371-psolfactory receptor pseudogene 1371101254145712542408Rat
1332914Olr1430-psolfactory receptor pseudogene 1430104418759044188526Rat
1332925Olr1370olfactory receptor 1370101252128912522230Rat
1564148RGD1564148similar to microfibrillar-associated protein 1105522222355223722Rat
1334290Olr1369olfactory receptor 1369101250844512509386Rat
1333024Olr1385olfactory receptor 1385103436026534361212Rat
1333051Olr1443olfactory receptor 1443104454756444548484Rat
1311948Cramp1cramped chromatin regulator homolog 1101432479914373413Rat
1333553Olr1367-psolfactory receptor pseudogene 1367101247861212479572Rat
1333482Olr1516olfactory receptor 1516106107127861072249Rat
1559974Calcoco2calcium binding and coiled-coil domain 2108393508783963750Rat
1334368Olr1368olfactory receptor 1368101249012712491068Rat
1359535Pigqphosphatidylinositol glycan anchor biosynthesis, class Q101528953015305593Rat
1333036Olr1414olfactory receptor 1414104391194743912900Rat
1311189Zzef1zinc finger ZZ-type and EF-hand domain containing 1105936093959498545Rat
1311190Ptx4pentraxin 4101448104414486277Rat
1559998Ccdc154coiled-coil domain containing 154101451824014529920Rat
1334086Olr1376olfactory receptor 1376101267313612674077Rat
1334375Olr1359-psolfactory receptor pseudogene 1359101229628312297225Rat
1560058Phb-ps1prohibitin, pseudogene 1106892541668926320Rat
1564698RGD1564698similar to ribosomal protein S10101971526219715845Rat
1333012Olr1482olfactory receptor 1482106023564260236447Rat
1333017Olr1479olfactory receptor 1479106019029360191228Rat
1562251Ccdc69coiled-coil domain containing 69104039245940419567Rat
1334298Olr1379-psolfactory receptor pseudogene 1379101275598512756173Rat
1563269Rapgefl1Rap guanine nucleotide exchange factor like 1108674922086765677Rat
1359733Trap1TNF receptor-associated protein 1101172403211757682Rat
1359736Tmem98transmembrane protein 98106817338068184289Rat
735194Snap47synaptosome associated protein 47104575719645798734Rat
1332960Olr1518-psolfactory receptor pseudogene 1518106111891561119664Rat
1333732Olr1399olfactory receptor 1399103475609434757029Rat
1333736Olr1423olfactory receptor 1423104412201644122978Rat
1333743Olr1451olfactory receptor 1451104470674444707463Rat
1562152RGD1562152similar to DNA segment, Chr 13, Wayne State University 177, expressed102997229729973450Rat
1563134RGD1563134similar to 60S ribosomal protein L29 (P23)106114242661152305Rat
1562309Krtap2-4keratin associated protein 2-4108753473687535481Rat
1311794Abi3ABI family, member 3108364408683655182Rat
1311801Syngr3synaptogyrin 3101405141314056169Rat
1311901Rhbdl3rhomboid like 3106767699967731670Rat
1303044Krt15keratin 15108804680388050622Rat
1560116Eftud2elongation factor Tu GTP binding domain containing 2109093207190983971Rat
1564837Mis12MIS12 kinetochore complex component105765368557661833Rat
1359135Mink1misshapen-like kinase 1105718531057238531Rat
1359182Krt42keratin 42108816550188219966Rat
1359571Timd2T-cell immunoglobulin and mucin domain containing 2103175547331796423Rat
1332969Olr1381olfactory receptor 1381101223516612236107Rat
1359436Pigsphosphatidylinositol glycan anchor biosynthesis, class S106559163865606175Rat
1359453Cct6bchaperonin containing TCP1 subunit 6B107006947970118194Rat
1333300Olr1383olfactory receptor 1383103430025034301197Rat
1560113Hoxb4homeo box B4108416733184169913Rat
1559875Heatr9HEAT repeat containing 9107072606870736707Rat
1566232Mrm1mitochondrial rRNA methyltransferase 1107213624172143075Rat
1583064LOC687643similar to 60S ribosomal protein L13 (A52)105633651956336989Rat
1565284Pirtphosphoinositide-interacting regulator of transient receptor potential channels105346687053485096Rat
1564542Cntd1cyclin N-terminal domain containing 1108919998889210369Rat
1586382Sox30SRY-box transcription factor 30103107425131102211Rat
727916Rfflring finger and FYVE-like domain containing E3 ubiquitin protein ligase107015762170220618Rat
3380Ppp2caprotein phosphatase 2 catalytic subunit alpha103753444937554861Rat
1566257RGD1566257similar to Related RAS viral (r-ras) oncogene homolog 2104751442047515063Rat
1586044Olr1384olfactory receptor gene Olr1384103433236434333305Rat
1565681Cenpvcentromere protein V104884651348861893Rat
1583566Dnase1l2deoxyribonuclease 1 like 2101381233513814514Rat
1587320LOC363679similar to GLE1 RNA export mediator-like (yeast108776600487772771Rat
1587322LOC363655similar to 40S ribosomal protein S15 (RIG protein)106332010563320575Rat
1587323LOC363652hypothetical LOC363652106725055767251189Rat
1587326Polr2aRNA polymerase II subunit A105633927756364888Rat
1587327LOC363622similar to 40S ribosomal protein S2105311195653113119Rat
1583007Slfn1schlafen family member 1107039387970400340Rat
1359604Ttc1tetratricopeptide repeat domain 1102934249529367865Rat
1585798Tubg2tubulin, gamma 2108906922389075589Rat
1559667RGD1559667similar to basic transcription factor 3104706333547063965Rat
1563106Ctc1CST telomere replication complex component 1105559617255616873Rat
1582743LOC691571similar to Shwachman-Bodian-Diamond syndrome104595264745961253Rat
1585988Xaf1XIAP associated factor 1105886064758872782Rat
1560788Bcas3BCAS3, microtubule associated cell migration factor107275654873271851Rat
1566120Meikinmeiotic kinetochore factor103972637339776458Rat
1559806RGD1559806similar to high mobility group protein102224388022244534Rat
1561062Fam117afamily with sequence similarity 117, member A108315480083198679Rat
1565522Tmem132etransmembrane protein 132E106973553469794975Rat
1565523Lsm11LSM11, U7 small nuclear RNA associated103102356131041700Rat
1586597LOC686099similar to expressed in non-metastatic cells 1, protein (NM23A) (nucleoside diphosphate kinase)106749365267494211Rat
1584711Prss41serine protease 41101317978113187461Rat
1359138Slc16a13solute carrier family 16, member 13105682759156831324Rat
1565395RGD1565395similar to stathmin 1/oncoprotein 18)108314741683147903Rat
1359248Kif2bkinesin family member 2B107909558879097807Rat
1582887LOC690222similar to WW domain binding protein 11103436342334365352Rat
1587402LOC691189hypothetical protein LOC691189108571316185717801Rat
1583720LOC501727similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)108793610687936728Rat
1583721LOC501718similar to dual specificity phosphatase 26108529524885296152Rat
1585065LOC691352similar to Robo-1104423835444243402Rat
1583877H3f4H3.4 histone104530469645305106Rat
1583885H2bu1H2B.U histone 1104529663845297385Rat
1585025LOC691392similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)104692341046924341Rat
1587434Epopelongin BC and polycomb repressive complex 2 associated protein108557336985574889Rat
1583204Meiobmeiosis specific with OB-fold101417464514206026Rat
1563128Arl5cADP-ribosylation factor like GTPase 5C108593983685948131Rat
1562673Zg16bzymogen granule protein 16B101332071613325134Rat
1564228NagluN-acetyl-alpha-glucosaminidase108897936388986879Rat
1566329Zfp652zinc finger protein 652108355680983572014Rat
1561727Proca1protein interacting with cyclin A1106545445165469491Rat
1564616Sowahasosondowah ankyrin repeat domain family member A103883615838838932Rat
1566089LOC303448similar to glyceraldehyde-3-phosphate dehydrogenase107868765378696097Rat
1563273Zfp879zinc finger protein 879103632663336336628Rat
1583913LOC691460similar to Cofilin-2 (Cofilin, muscle isoform)104515457145155096Rat
1561017RGD1561017similar to hypothetical protein 4930474N05104154466041546328Rat
1565950Adamts2ADAM metallopeptidase with thrombospondin type 1 motif, 2103609805136304416Rat
1563878Asb16ankyrin repeat and SOCS box-containing 16109021797990224984Rat
1562355RGD1562355similar to ATPase, H+ transporting, V1 subunit G isoform 1102980687029807209Rat
1565247Unklunk like zinc finger101454712614593090Rat
1565783NagsN-acetylglutamate synthase109008460790089693Rat
1565784RGD1565784RGD1565784101454319614544498Rat
1559709Fbxo47F-box protein 47108579898785829770Rat
1560191Zfp62zinc finger protein 62103447710834493941Rat
1563281Lrrc3cleucine rich repeat containing 3C108655476186565800Rat
1562928Cxcl16C-X-C motif chemokine ligand 16105706000557064600Rat
1562573Zfp830zinc finger protein 830107011825070119714Rat
1566146Krtap4-3keratin associated protein 4-3108775284887753685Rat
1562276Ccdc92bcoiled-coil domain containing 92B106140312061424262Rat
1561189Retreg3reticulophagy regulator family member 3108900659589030595Rat
1562610Zfp2zinc finger protein 2103638813636406721Rat
1563555Fam71bfamily with sequence similarity 71, member B103150854931511787Rat
1563563RGD1563563similar to peptidylprolyl isomerase D108266207482671952Rat
1562142Hoxb6homeo box B6108414733184150238Rat
1564621Smcr8SMCR8-C9orf72 complex subunit104701932647026465Rat
1564623Ovca2OVCA2 serine hydrolase domain containing106201734762020509Rat
1564778Msl1MSL complex subunit 1108671092586722659Rat
1564411Slfn3schlafen family member 3107043801270477259Rat
1562626Tom1l1target of myb1 like 1 membrane trafficking protein107817384778219805Rat
1559552Med1mediator complex subunit 1108610156086145271Rat
1584011LOC690160similar to WW domain binding protein 11103430304734313706Rat
1561732Mslnlmesothelin-like101510304715119427Rat
1561735LOC303140up-regulator of carnitine transporter, OCTN2103929690439324861Rat
1359463Mfap3microfibril associated protein 3104293307742945591Rat
1562576Ranbp17RAN binding protein 17101813976318445347Rat
1566204Heatr6HEAT repeat containing 6107105434471083229Rat
1584381Hs3st6heparan sulfate-glucosamine 3-sulfotransferase 6101412285614128984Rat
1561464Atad5ATPase family, AAA domain containing 5106742704267475825Rat
1565533Cfap97d1CFAP97 domain containing 1108991831389930913Rat
1561650Aarsd1alanyl-tRNA synthetase domain containing 1108931797489331078Rat
1566174Trim58tripartite motif-containing 58104427158744282726Rat
1566149Fam222bfamily with sequence similarity 222, member B106535124565416869Rat
1565186Mks1MKS transition zone complex subunit 1107514981475160481Rat
1359618Dhx40DEAH-box helicase 40107408144274119032Rat
1565611RGD1565611RGD1565611106417492964178612Rat
1565378Spata22spermatogenesis associated 22105989306459910769Rat
1561602Nlknemo like kinase106584005265963932Rat
1584376Cd300lgCd300 molecule-like family member G108997647889995621Rat
61861Gabra6gamma-aminobutyric acid type A receptor subunit alpha6102784744727862896Rat
1561262Hs3st3a1heparan sulfate-glucosamine 3-sulfotransferase 3A1105092830951014562Rat
1564531Trpv3transient receptor potential cation channel, subfamily V, member 3105982975559863780Rat
1561281Krtap2-1keratin associated protein 2-1108752918187529727Rat
1562631Tlcd2TLC domain containing 2106230312462306198Rat
1359624Wrap53WD repeat containing, antisense to TP53105616902456185800Rat
1563441Rnf227ring finger protein 227105594053355941205Rat
1563442Zfp385czinc finger protein 385C108854175988597058Rat
1564565Med24mediator complex subunit 24108662016686658014Rat
1563669Med9mediator complex subunit 9104631463946329374Rat
1561538Slfn14schlafen family member 14107049334070504810Rat
1561541Prr11proline rich 11107439368374436073Rat
1582982LOC688925similar to Glutathione S-transferase alpha-4107042431370424935Rat
1582808Ttc19tetratricopeptide repeat domain 19104859932148627374Rat
1565835Wfikkn1WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1101524342915245757Rat
1565126Atp10bATPase phospholipid transporting 10B (putative)102844924828862423Rat
1565317RGD1565317similar to ubiquitin-like/S30 ribosomal fusion protein106650909266509537Rat
1582828HlfHLF transcription factor, PAR bZIP family member107783635277918656Rat
1586325Dppa1developmental pluripotency associated 1103169321931712924Rat
1592933Krtap9-7keratin associated protein 9-7108778235187783094Rat
1592397Prr15lproline rich 15-like108486678184873434Rat
1592404LOC688156similar to ribosomal protein L15108370358583704324Rat
1592405B4galnt2beta-1,4-N-acetyl-galactosaminyl transferase 2108367776883701487Rat
1592414Rsad1radical S-adenosyl methionine domain containing 1108226910482276599Rat
1591208LOC688214hypothetical protein LOC688214109056880290578483Rat
1592971Olr1873olfactory receptor 1873106075074760751745Rat
1592386Pgap3post-GPI attachment to proteins phospholipase 3108634305886356146Rat
1592387Tcaptitin-cap108633770586338414Rat
1586365LOC689935similar to ribosomal protein L27a107545835975459384Rat
1593783LOC685475hypothetical protein LOC685475106614669366163653Rat
1591123LOC689504similar to 40S ribosomal protein S19102682275026823200Rat
1592078Sp2Sp2 transcription factor108489093084920886Rat
1592079Mmdmonocyte to macrophage differentiation-associated107768796477783737Rat
1592080LOC303431hypothetical LOC303431107621505376215556Rat
1592081Mpomyeloperoxidase107508789275098260Rat
1592280LOC689482similar to 60S ribosomal protein L7a102657158626573252Rat
1585960Smtnl2smoothelin-like 2105895184558973020Rat
1592433LOC688126hypothetical protein LOC688126107365910973660475Rat
1592316LOC689446similar to apoptosis inhibitor 5102619672326198934Rat
1590287Btnl9butyrophilin-like 9103442483034443749Rat
1593000Krtap9-1keratin associated protein 9-1108775978187760576Rat
1590981LOC690852hypothetical protein LOC690852103779717137797758Rat
1591007Gngt2G protein subunit gamma transducin 2108365432183658601Rat
1588823LOC688465similar to RAN guanine nucleotide release factor106855654068557500Rat
1583741Mrpl28mitochondrial ribosomal protein L28101549561615498527Rat
1583742Prss33serine protease 33101317350913176288Rat
1592448Hsf5heat shock transcription factor 5107490962174954128Rat
1588807Efcab9EF-hand calcium binding domain 9101739929117406915Rat
1585017Adam19ADAM metallopeptidase domain 19103114610731240582Rat
1585207LOC690001similar to surfeit gene 6103186990531871767Rat
1586495Ccl1C-C motif chemokine ligand 1106953497669537836Rat
1584685Vps25vacuolar protein sorting 25 homolog108917468489180165Rat
1589060Rprmlreprimo-like109171049591711499Rat
1587783LOC685992similar to 60S ribosomal protein L8101630581716308350Rat
1586539Tvp23btrans-golgi network vesicle protein 23 homolog B104929912549312814Rat
1586211Hoxb8homeo box B8108413148484133874Rat
1586284Faxdc2fatty acid hydroxylase domain containing 2104350082543526376Rat
1586291LOC691212hypothetical protein LOC691212104334004743340370Rat
2592Fabp6fatty acid binding protein 6102919162129196593Rat
1589910LOC689668similar to 40S ribosomal protein S2102927842829279385Rat
1590959LOC690875similar to 40S ribosomal protein S2103864497738645871Rat
1585015Ergic1endoplasmic reticulum-golgi intermediate compartment 1101682139316912050Rat
1583243Msrb1methionine sulfoxide reductase B1101410575014111463Rat
1586275Gemin5gem (nuclear organelle) associated protein 5104355226043599241Rat
1565881Zfp3zinc finger protein 3105738622857394471Rat
1566009Slx4SLX4 structure-specific endonuclease subunit101178775611808326Rat
1588845LOC688443hypothetical protein LOC688443101719118817191773Rat
1588238Casp16caspase 16101287893312885492Rat
1589937LOC689641similar to ATPase inhibitor, mitochondrial precursor102924572729246229Rat
1588526LOC363567similar to Tropomyosin 1 alpha chain (Alpha-tropomyosin)102493634224937526Rat
1588527LOC363565similar to thyroid hormone receptor associated protein 3102261692722621502Rat
1590900Pno1-ps1partner of NOB1 homolog (S. cerevisiae), pseudogene 1109033544590336715Rat
1590901Krt16keratin 16108814921088152167Rat
1590902Cct6a-ps2chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 2108765545787657447Rat
1584857LOC501698similar to olfactory receptor Olr1448104450609844506967Rat
1584858LOC501687similar to SLD5103009112130091820Rat
1587490Srsf1serine and arginine rich splicing factor 1107533420075341197Rat
1303002Cops3COP9 signalosome subunit 3104618268046206083Rat
61885Pitpnaphosphatidylinositol transfer protein, alpha106373176763772049Rat
1588894Gid4GID complex subunit 4104678412446810517Rat
1586225LOC691286similar to RIKEN cDNA 4930504O13104388447543893354Rat
1586251Lypd8LY6/PLAUR domain containing 8104381777343828812Rat
1586234LOC691277similar to Robo-1104385195043856911Rat
1590933Ybx1-ps3Y box protein 1 related, pseudogene 3104038035740381897Rat
1587037LOC680846similar to ribosomal protein L37106220059662201183Rat
1585185Hils1histone linker H1 domain, spermatid-specific 1108277569182776487Rat
1590939Sh3bp5lSH3 binding domain protein 5 like104376862043785702Rat
1593289Pyypeptide YY109004798990049155Rat
1593294Nlrp1bNLR family, pyrin domain containing 1B105775595757847867Rat
1593297LOC691995hypothetical protein LOC691995105766952957671080Rat
1593298LOC691994similar to chromobox homolog 3105766497657666044Rat
1593299ScimpSLP adaptor and CSK interacting membrane protein105741542957436412Rat
1593301Rpl36a-ps2ribosomal protein L36a, pseudogene 2105725120257251603Rat
1593310Tmem95transmembrane protein 95105648677856488723Rat
1593311Spem1spermatid maturation 1105642844756429748Rat
1595127LOC685321similar to protease, serine, 28101466829814670598Rat
1596210LOC687893similar to olfactory receptor Olr1501106083599760836932Rat
1591334Nme4NME/NM23 nucleoside diphosphate kinase 4101546156715465422Rat
1596224LOC687879similar to olfactory receptor 390106061138460612278Rat
1595464LOC680160similar to keratin associated protein 4-7108754921187549802Rat
1596391Lyrm7LYR motif containing 7104018306140201992Rat
1598335Prr35proline rich 35101530892015314245Rat
1595518Krtap1-3keratin associated protein 1-3108750982287510645Rat
1597447LOC689039hypothetical protein LOC689039107065584270659380Rat
1595918Smg6SMG6 nonsense mediated mRNA decay factor106177191262007030Rat
1595918Smg6SMG6 nonsense mediated mRNA decay factor106152602461542583Rat
1596488Rskrribosomal protein S6 kinase related106555278065557285Rat
1592427Mbtd1mbt domain containing 1108158823381645532Rat
1591746Krtap31-1keratin associated protein 31-1108783276687833698Rat
1591758LOC680442hypothetical protein LOC680442108781913287819714Rat
1592062Gsdmagasdermin A108656989886595102Rat
1591772LOC680428hypothetical protein LOC680428108780846087809411Rat
1595947Lrrc75aleucine rich repeat containing 75A104892951948947606Rat
1592603Mcrip2MAPK regulated co-repressor interacting protein 2101523080115235740Rat
1592624LOC685523similar to ribosomal protein L27a106655831866558813Rat
1596828Krtap3-2keratin associated protein 3-2108747517887475869Rat
1596207LOC687896hypothetical protein LOC687896106084933060850280Rat
1593396LOC690675similar to Cytochrome c, somatic103650198036502362Rat
1593534Mat2bmethionine adenosyltransferase 2B102583209625848045Rat
1588626Mrpl10mitochondrial ribosomal protein L10108497637784984793Rat
1589435LOC680641similar to 40S ribosomal protein S9101275479712755374Rat
1592359Rpl37a-ps3ribosomal protein L37a, pseudogene 3107228287272283234Rat
1590296LOC684471similar to olfactory receptor 1394103439569534416337Rat
1593405Tmem92transmembrane protein 92108254523882575822Rat
1593411Hint1histidine triad nucleotide binding protein 1104020823640211981Rat
1594586LOC287625similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)107944581279446909Rat
1594623Cox10cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10105043977850563920Rat
1592339LOC689422similar to 60S ribosomal protein L32102600285426004661Rat
1595998Tnfrsf13bTNF receptor superfamily member 13B104739983447422907Rat
1596844LOC680043similar to adenosine kinase108747006087471162Rat
1597232Rps4x-ps6ribosomal protein S4, X-linked, pseudogene 6104681464946815803Rat
1593331Rps4x-ps7ribosomal protein S4, X-linked, pseudogene 7105551972255524678Rat
1593242Mettl16methyltransferase like 16106162659561682947Rat
1589404Rps4x-ps5ribosomal protein S4, X-linked, pseudogene 5101278013912780913Rat
1597577LOC687707hypothetical protein LOC687707105723999357240948Rat
1594823LOC689229similar to GC-rich promoter binding protein 1-like 1102480607424809588Rat
1594396Trim25tripartite motif-containing 25107634384776362159Rat
1589570Tpcr12putative olfactory receptor103440241234403587Rat
1596276Haspinhistone H3 associated protein kinase105969540359698398Rat
1594715Cby3chibby family member 3103585532035860266Rat
1586332LOC689968similar to kidney injury molecule 1103164751931661204Rat
1596222LOC687881similar to olfactory receptor 394106062540160626160Rat
1593621Suz12SUZ12 polycomb repressive complex 2 subunit106732510167371588Rat
1593806Gng13G protein subunit gamma 13101508893515090839Rat
1595488Krtap2-4lkeratin associated protein 2-4-like108752116587521615Rat
1596817Krtap3-1keratin associated protein 3-1108748435487484983Rat
1586338Ccdc182coiled-coil domain containing 182107561986775621629Rat
1595962LOC691761hypothetical protein LOC691761104886860348869542Rat
1595972Tmem107transmembrane protein 107105565369455656270Rat
1596776LOC681314similar to BAX protein, cytoplasmic isoform delta108950970489510468Rat
1596463Gpatch8G patch domain containing 8109042144390501996Rat
1593257LOC303341hypothetical LOC303341106362774463628886Rat
1593824Evi2aecotropic viral integration site 2A106687004866873948Rat
1598226Znhit3zinc finger, HIT-type containing 3107222771072235932Rat
1598227LOC497963similar to Nitric oxide synthase, inducible (NOS type II) (Inducible NO synthase) (Inducible NOS) (iNOS)106628217166313373Rat
1598228LOC497952similar to Ubiquitin-associated protein 2-like106096430360967254Rat
1598229Slc25a35solute carrier family 25, member 35105555491155559083Rat
1598163Pam16presequence translocase associated motor 16101114635911153936Rat
1598224Krtap1-5keratin associated protein 1-5108750052587500893Rat
1596719Nufip2nuclear FMR1 interacting protein 2106516814565200210Rat
1596720Bricd5BRICHOS domain containing 5101383959913841132Rat
1596730LOC681360similar to MIPP65 protein108972244789729230Rat
1596731E4f1E4F transcription factor 1101381233513835847Rat
1594678Ankrd40ankyrin repeat domain 40108203265682045937Rat
1596424LOC685273similar to U1 small nuclear ribonucleoprotein C (U1 snRNP protein C) (U1C protein) (U1-C)101453266014533402Rat
1596428Itga2bintegrin subunit alpha 2b109039796090416550Rat
1642427Zfp867zinc finger protein 867104580912145819530Rat
2293499Tedc2tubulin epsilon and delta complex 2101358685213591938Rat
2293818Phykpl5-phosphohydroxy-L-lysine phospho-lyase103493866134960661Rat
2303312Spns2sphingolipid transporter 2105901042859049482Rat
2303824Usp43ubiquitin specific peptidase 43105440698054467956Rat
2319718LOC100361655rCG33642-like109128146591291830Rat
2318500LOC100362285ribosomal protein L15-like104598238345983018Rat
2319111LOC100361969keratin associated protein 4-7-like108755603087556616Rat
2318578Krtap16-1keratin associated protein 16-1108791910087920581Rat
2318580Fndc9fibronectin type III domain containing 9103132210831325634Rat
2319914LOC100361553hypothetical LOC100361553108385850183859117Rat
2318090LOC100362498extracellular peptidase inhibitor-like107101355471014426Rat
2318759Ift140intraflagellar transport 140101437366814461509Rat
2318188LOC10036240060S ribosomal protein L13-like104032264840323373Rat
2318794LOC100365588keratin associated protein 1-3-like108751646587517177Rat
2319448LOC100365226hypothetical LOC100365226103202300632023900Rat
2320105Insyn2binhibitory synaptic factor family member 2B101927095619392214Rat
2319496LOC100361778NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4102610530526106274Rat
2319497LOC100361777translocase of outer mitochondrial membrane 7 homolog105715243057159503Rat
2319509Hoxb2homeobox B2108420085984203065Rat
2318339Fnip1folliculin interacting protein 1103978668739870188Rat
2318949LOC100362031hypothetical protein LOC100362031108758588887586650Rat
2318953LOC100362027ribosomal protein L30-like103802446038024945Rat
2319558LOC100361716serine/threonine-protein kinase 17B-like104394018543941275Rat
2320203LOC100364862hypothetical protein LOC100364862108784687087849124Rat
2319678LOC100361695NHP2 non-histone chromosome protein 2-like 1-like102514552225145898Rat
2322743LOC100360106rCG32548-like103412003434122017Rat
2322150Tsr1TSR1, ribosome maturation factor106174607061757518Rat
2322151LOC100360405hypothetical LOC100360405103460239534603484Rat
2321462LOC100360796succinate dehydrogenase-like103785868237859140Rat
2322220LOC100363835transcription elongation factor B (SIII), polypeptide 2-like107628863076288969Rat
2321477LOC100360781ribosomal protein L37-like106433616264336558Rat
2322885LOC100360060ribosomal protein L30-like103410968734110898Rat
2321534LOC100360724bolA-like 1-like106508010365107471Rat
2321564LOC100364194transmembrane protein 92-like108248779682492944Rat
2322930Car10carbonic anhydrase 10108079015181297621Rat
2322345Fam83gfamily with sequence similarity 83, member G104796073547984083Rat
2322976LOC100363469ribosomal protein S24-like107899254078993047Rat
2323022LOC100363423rCG35357-like107821272478244262Rat
2320893LOC100361067proteasome subunit alpha type-3-like106583509265836317Rat
2320907Hbq1bhemoglobin subunit theta 1B101559982115602680Rat
2320914LOC100361046casein kinase 1, alpha 1-like103400388634005667Rat
2321712LOC100360645ubiquitin B-like104969911549699424Rat
2323127LOC100359917hypothetical LOC100359917106024908560249880Rat
2322499Rpl31l2ribosomal protein L31-like 2103435570734356181Rat
2321071LOC100360989casein kinase 2, alpha 1 polypeptide103946725339468455Rat
2322651LOC100360198WW domain binding protein 11-like103433553934338609Rat
2321952LOC100360505lethal (2) 06225-like106209050062091409Rat
2323463LOC100359777mCG12681-like103160361331620449Rat
2323480LOC100359760lymphocyte antigen 6 complex, locus E105995876159959417Rat
2324272LOC100362686hemoglobin, theta T1101557481315587426Rat
2324311LOC100362647cytochrome c oxidase subunit VIIb-like107224717972247542Rat
2323679LOC100359515rCG35337-like106478681164790215Rat
2323679LOC100359515rCG35337-like106476289464781478Rat
4888546Mir193amicroRNA 193a106706588567065996Rat
2323798LOC100359495ribosomal protein L37a-like105574084255741365Rat
2323819LOC100359474dCTP pyrophosphatase 1-like104617334446175029Rat
4888561Mir3547microRNA 3547101460313414603243Rat
2325346Mir195microRNA 195105684530156845387Rat
2325359Mir423microRNA 423106309836663098444Rat
2325364Mir497microRNA 497105684497756845045Rat
2325371Mir365bmicroRNA 365b106707979667079881Rat
2325376Mir212microRNA 212106201470262014812Rat
2325379Mir193microRNA 193106706589667065981Rat
2325382Mir146amicroRNA 146a102896247628962570Rat
2325403Mir336microRNA 336103534975635349851Rat
2325405Mir301amicroRNA 301a107441774674417845Rat
2325418Mir196cmicroRNA 196c108411357884113657Rat
2325428Mir144microRNA 144106529136565291447Rat
2325436Mir324microRNA 324105662112656621208Rat
2323961Cdrt4CMT1A duplicated region transcript 4104936818349400284Rat
2325479Mir632microRNA 632106776296567763042Rat
2325534Mir451amicroRNA 451a106529120465291275Rat
2325546Mir218-2microRNA 218-2102042866120428770Rat
2325564Mir152microRNA 152108471931984719403Rat
2325567Mir142microRNA 142107505083975050925Rat
2325572Mir132microRNA 132106201499562015095Rat
2324080LOC100362778U1 small nuclear ribonucleoprotein 1C104384194543842424Rat
2325579Mir103a1microRNA 103a-1102060671520606800Rat
2325597Mir22microRNA 22106229959262299686Rat
2325598Mir21microRNA 21107390221073902301Rat
2325601Mir10amicroRNA 10a108416595084166059Rat
2324125Irgm2immunity-related GTPase family M member 2104364550843655657Rat
2324575Krtap1-1keratin associated protein 1-1108750295087503578Rat
6486357LOC100912585mitogen-activated protein kinase 7-like104900404349010581Rat
6489771LOC100911946uncharacterized LOC100911946105446836754469859Rat
6488263LOC100912181uncharacterized LOC100912181107050971970512814Rat
6488990LOC100912068hypermethylated in cancer 1 protein-like106248060162483619Rat
6489971LOC100911861transcription elongation factor B polypeptide 2-like107630350276305723Rat
6488615LOC10091212060S ribosomal protein L18-like104582734745828566Rat
6489293LOC100912001olfactory receptor 1P1-like106241427062415240Rat
6485238LOC10091294140S ribosomal protein S10-like108189318581894434Rat
6488831LOC100912159olfactory receptor 1361-like101243317712434386Rat
6491771LOC100911674protein GTLF3B-like104506146445071692Rat
6491978LOC100911586olfactory receptor 2AK2-like104501468845015608Rat
6493203LOC100911398olfactory receptor 2AK2-like104486085544861799Rat
6493276LOC100911409olfactory receptor 1361-like101208083012081792Rat
6486207LOC100912549keratin-associated protein 4-3-like108756954287578854Rat
6486396LOC100912586keratin-associated protein 4-3-like108770248687703250Rat
6486589LOC100912483uncharacterized LOC100912483105878444458787713Rat
6495116LOC100911112uncharacterized LOC100911112108258188782582757Rat
6495127LOC100911111uncharacterized LOC100911111104534600545350021Rat
6494481Med7mediator complex subunit 7103153219031536405Rat
6492817LOC100911479olfactory receptor 2AK2-like104493352944934494Rat
6490803LOC100911746B9 domain-containing protein 1-like104778430747797278Rat
6493616LOC100911361heterogeneous nuclear ribonucleoprotein A3-like108095293480954692Rat
6490288LOC100911896uncharacterized LOC100911896106775309767754115Rat
6498778LOC10091045560S ribosomal protein L19-like108586457485865284Rat
6502022LOC100909754olfactory receptor 1P1-like106106649261067463Rat
6502059LOC10090975540S ribosomal protein S27-like107050669470506979Rat
6495555LOC100910970uncharacterized LOC100910970103730945637327993Rat
6502209LOC100909659bolA-like protein 2-like106514362365149133Rat
6502228LOC100909660extracellular peptidase inhibitor-like107096439670966543Rat
6502238LOC100909661putative keratin-associated protein 10-like ENSP00000375147 homolog108789677187898252Rat
6495741LOC100910998transmembrane protein 92-like108253343882534476Rat
6499175LOC10091027760S ribosomal protein L24-like105338616053386647Rat
6495889LOC100910915nmrA-like family domain-containing protein 1-like101135815911362777Rat
6495913LOC100910926eukaryotic translation initiation factor 5A-1-like101273795212738443Rat
6495961Evi2becotropic viral integration site 2B106685698066858598Rat
6495966LOC100910876olfactory receptor 2AK2-like104447099544471915Rat
6499350Trappc2btrafficking protein particle complex 2B103503617635040918Rat
6499408LOC10091021160S ribosomal protein L15-like105329758853298209Rat
6496100Derl2derlin 2105764168257653554Rat
6496208LOC100910837olfactory receptor 2AK2-like104437530144376221Rat
6499517LOC100910236septin-4-like107654653976547116Rat
6502864LOC100909534olfactory receptor 1-like106023102760231971Rat
6502978LOC100909554lanC-like protein 3-like103365455733655655Rat
6496445LOC100910875protein FAM100A-like101133762311343079Rat
6503103LOC100909578olfactory receptor 1496-like106050353560504467Rat
6503249LOC100909493olfactory receptor-like protein I9-like106021985160220898Rat
6503260LOC100909494keratin-associated protein 4-7-like108770810187708700Rat
6496829LOC100910814keratin-associated protein 9-1-like108778850587789067Rat
6500115LOC10091010540S ribosomal protein S6-like107514729675149815Rat
6503435Nhlrc4NHL repeat containing 4101530572315306534Rat
6497071LOC100910731keratin-associated protein 4-12-like108771475087731249Rat
6497567LOC10091057960S ribosomal protein L10a-like105565752955661520Rat
6497652LOC100910596uncharacterized LOC100910596101681058116814801Rat
6576114Trnat-agutransfer RNA threonine (anticodon AGU)105569704655697119Rat
6576114Trnat-agutransfer RNA threonine (anticodon AGU)105564503655645109Rat
6576114Trnat-agutransfer RNA threonine (anticodon AGU)105561814455618217Rat
6497740LOC100910623uncharacterized LOC100910623101287469412877145Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)103418216934182241Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)101287609912876171Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)101286116812861240Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)101285434212854414Rat
6576126Trnak-cuutransfer RNA lysine (anticodon CUU)101285273812852810Rat
6576138Trnas-gcutransfer RNA serine (anticodon GCU)105564533255645413Rat
6498388LOC100910494peroxiredoxin-6-like105549105255492148Rat
7528116LOC102557195uncharacterized LOC102557195105597079755990535Rat
7496412LOC102551430uncharacterized LOC102551430101188642011887877Rat
7496505LOC102557601uncharacterized LOC102557601107626134476262962Rat
7499005LOC102552659receptor tyrosine-protein kinase erbB-2-like108483905384845803Rat
7500255LOC102555400uncharacterized LOC102555400103570812735711973Rat
7517962LOC102552988uncharacterized LOC102552988107146216871493312Rat
7518009LOC102553843uncharacterized LOC102553843103499113934993804Rat
7518044LOC102553386SUMO-conjugating enzyme UBC9-like107214768072148784Rat
7518212LOC102547424uncharacterized LOC102547424102451668024586498Rat
7518266LOC10255230440S ribosomal protein S2-like108473920784743806Rat
7518371LOC102555997uncharacterized LOC102555997104531500745321502Rat
7489039Mir6326microRNA 6326106229933962299449Rat
7521605LOC102557246glyceraldehyde-3-phosphate dehydrogenase-like107461961074623180Rat
7522770LOC102551496uncharacterized LOC102551496106495051964951216Rat
7522823LOC102557028uncharacterized LOC102557028103428045334288414Rat
7523136LOC102550019uncharacterized LOC102550019102998316829998004Rat
7523178LOC102554159uncharacterized LOC102554159105198833152049489Rat
7524038LOC102550048uncharacterized LOC102550048101643688016487654Rat
7527073LOC102557224uncharacterized LOC102557224105608456856088417Rat
7489011Mir6327microRNA 6327106897760168977733Rat
7527442LOC102552952uncharacterized LOC102552952104936313449368098Rat
7527654LOC102546527uncharacterized LOC102546527108976023189763899Rat
7505899LOC102555853ATP synthase subunit g, mitochondrial-like105574329355745999Rat
7522365LOC102556059uncharacterized LOC102556059104535318545356395Rat
7529496Znf454zinc finger protein 454103636209736377774Rat
7530640LOC102555724uncharacterized LOC102555724105554992455551202Rat
7531350LOC10255608760S ribosomal protein L9-like106296723062967879Rat
7509733LOC102552016leucine-rich repeat-containing protein 37A2-like109154357891545449Rat
7510361LOC102550517uncharacterized LOC102550517103864463338658059Rat
7501583LOC102546946uncharacterized LOC102546946104507242745075462Rat
7502397LOC102546949uncharacterized LOC102546949105686736456882800Rat
7510604LOC102547784uncharacterized LOC102547784106967443069683223Rat
7511312LOC102555635zinc finger protein 39-like104519377145211045Rat
7502825Ac1576uncharacterized LOC102552783107134203571358887Rat
7503123LOC102547047uncharacterized LOC102547047108358462983636404Rat
7497167LOC102555790uncharacterized LOC102555790108233310282341155Rat
7498198Zfp174zinc finger protein 174101192815011935415Rat
7502415LOC102547753uncharacterized LOC102547753107680758276816927Rat
7536859LOC102547686uncharacterized LOC102547686109070011990701231Rat
7503660LOC10255278160S ribosomal protein L9-like101435928314361470Rat
7503661LOC102557019uncharacterized LOC102557019108278578582788442Rat
7516121LOC102550051uncharacterized LOC102550051106711084667129708Rat
7516956LOC102554192keratin-associated protein 29-1-like108791259587913614Rat
7517169LOC102548893uncharacterized LOC102548893103800324338028330Rat
7517671LOC102554449uncharacterized LOC102554449108806371588067946Rat
7539176LOC102557607pulmonary surfactant-associated protein D-like108535543385387193Rat
7519974LOC102551552uncharacterized LOC102551552106495084864953915Rat
7503945LOC102552369uncharacterized LOC102552369104892670248929449Rat
7520481Wdr90WD repeat domain 90101521166015229477Rat
7520906LOC102550942uncharacterized LOC102550942109077070390772162Rat
7612189LOC102557038uncharacterized LOC102557038101296585312966903Rat
7612562LOC102555975UPF0746 protein DDB_G0281095-like108949441489500503Rat
7613436LOC102557529uncharacterized LOC102557529107563246275642992Rat
7632735LOC10255288640S ribosomal protein S15a-like107137923771379694Rat
7648353LOC102550111uncharacterized LOC102550111109052918790541745Rat
7664110LOC102546446uncharacterized LOC102546446108976633889777991Rat
7614296LOC102547395uncharacterized LOC102547395105828470558314028Rat
7615022LOC102548672uncharacterized LOC102548672102711896627142562Rat
7633835LOC102551268uncharacterized LOC102551268101333875713353798Rat
7649594Dbf4bDBF4 zinc finger B109071046890723313Rat
7650165LOC102551978uncharacterized LOC102551978104824903248252472Rat
7650893LOC102547851uncharacterized LOC102547851105850215458525661Rat
7558326LOC102552843phosphoglycerate mutase 1-like106748239867484783Rat
7558919LOC102551062uncharacterized LOC102551062101151521811517470Rat
7622441LOC102549294uncharacterized LOC102549294106399378564038545Rat
7558982LOC102552882uncharacterized LOC102552882104154466041835362Rat
7560064LOC102555725olfactory receptor 1468-like106007691960083227Rat
7575650LOC102549733uncharacterized LOC102549733101617765216181306Rat
7624373LOC102549079putative 60S ribosomal protein L37a-like101542760915428187Rat
7624493LOC102553452uncharacterized LOC102553452104321098443223741Rat
7625432LOC102553022uncharacterized LOC102553022104187017541900815Rat
7655370LOC102550234uncharacterized LOC102550234106697202966973369Rat
7655392LOC10255748460S ribosomal protein L12-like106739177967393887Rat
7577315LOC102552548kinase suppressor of Ras 1-like106632244666342519Rat
7577702LOC102547555uncharacterized LOC102547555109072342790726239Rat
7625912LOC102547952uncharacterized LOC102547952101482394214826220Rat
7626388LOC102551327uncharacterized LOC102551327101359205813592817Rat
7595653LOC102553190uncharacterized LOC102553190107185018671860355Rat
7627866LOC102553977uncharacterized LOC102553977101303950513040825Rat
7642598LOC102546484mucin-12-like105641888156423317Rat
7608730LOC102547232uncharacterized LOC102547232106418317964188878Rat
7628561LOC10254821160S ribosomal protein L5-like107033015070331689Rat
7629087LOC102548607uncharacterized LOC102548607107838758178435085Rat
7630088LOC102555183zinc finger protein OZF-like107476753574770723Rat
7644068LOC102549326putative 60S ribosomal protein L37a-like106555869965562667Rat
7660262LOC102546598uncharacterized LOC102546598108313261283136336Rat
7660412LOC102546976uncharacterized LOC102546976109006759090070551Rat
7610492LOC102546328DNA-directed RNA polymerases I, II, and III subunit RPABC5-like108967430589675927Rat
7610927LOC102547852uncharacterized LOC102547852109074922390750973Rat
7630436LOC102548702uncharacterized LOC102548702103787152237890405Rat
7644542LOC102546326uncharacterized LOC102546326103664927836663565Rat
7611715LOC102554015uncharacterized LOC102554015108078563081007018Rat
7611738Krtap17-1keratin associated protein 17-1108792755087928321Rat
7555271LOC102553349uncharacterized LOC102553349104229512942345510Rat
7592610LOC102547278uncharacterized LOC102547278108491553184925468Rat
7593011LOC102552810uncharacterized LOC102552810104176531041784803Rat
7616496Gpx4-ps2glutathione peroxidase 4, pseudogene 2106376691063768764Rat
7616564LOC102554726uncharacterized LOC102554726105346224353468541Rat
7617190LOC102554819uncharacterized LOC102554819105350185853513002Rat
7589819LOC102548486uncharacterized LOC102548486109150955491515643Rat
7593322LOC102549418uncharacterized LOC102549418104645768946473572Rat
7617953LOC102551269uncharacterized LOC102551269103965076939654695Rat
7590619LOC102552748keratin-associated protein 9-2-like108486418984864723Rat
7596091LOC102551468teneurin-2-like102210317322113055Rat
7592181LOC102550168uncharacterized LOC102550168106705805767058778Rat
7619857LOC102552041uncharacterized LOC102552041101203574112039701Rat
7572891LOC102553069keratin-associated protein 4-6-like108756376287564327Rat
7573752LOC102557169uncharacterized LOC102557169106499194164996292Rat
7543976LOC102553816uncharacterized LOC102553816105167116451672060Rat
7546518LOC102553477uncharacterized LOC102553477101283610912841002Rat
7546533LOC102554532uncharacterized LOC102554532107535057875354398Rat
7561849LOC102555091nuclear envelope pore membrane protein POM 121-like103505700435060920Rat
7548161Pgbd2piggyBac transposable element derived 2104367166543673471Rat
7562538Znf354bzinc finger protein 354B103641173036423346Rat
7580290LOC102551976uncharacterized LOC102551976101389340413893942Rat
7563404LOC102549419uncharacterized LOC102549419106406069064073981Rat
7563800LOC102552078uncharacterized LOC102552078106809124968099890Rat
7582996LOC102547613uncharacterized LOC102547613109070861090712412Rat
7565656LOC102551823transmembrane protein 92-like108251756182521637Rat
7584706LOC102551820uncharacterized LOC102551820101651503916522849Rat
7566942LOC102554504N-lysine methyltransferase SETD8-like103178207231783118Rat
7567332LOC102552619uncharacterized LOC102552619104148953341491613Rat
7585951LOC102548642uncharacterized LOC102548642109169086591694669Rat
7553401LOC102552549migration and invasion enhancer 1-like108484625684847565Rat
7553451LOC10254879060S ribosomal protein L17-like105924147059243259Rat
7607460LOC102555690uncharacterized LOC102555690108185637581863056Rat
7607868LOC102547954uncharacterized LOC102547954107013351070134603Rat
7607939LOC102549635uncharacterized LOC102549635101908936819092739Rat
7567970LOC102551876uncharacterized LOC102551876101658329516628936Rat
7568005LOC102554092uncharacterized LOC102554092107325658073278699Rat
7568369LOC102550580uncharacterized LOC102550580108419572784199531Rat
7587933LOC102552476uncharacterized LOC102552476101693865316964198Rat
7554930LOC102554448glyceraldehyde-3-phosphate dehydrogenase-like105308033853081146Rat
7691225LOC102548673uncharacterized LOC102548673107880009478818514Rat
7735524LOC102551619uncharacterized LOC102551619101379639213797480Rat
7735698LOC102546674uncharacterized LOC102546674108315105483161738Rat
7692069LOC10254707660S ribosomal protein L7a-like101863635818637285Rat
7736477Ankfn1ankyrin-repeat and fibronectin type III domain containing 1107690168177210042Rat
7692635LOC102550128uncharacterized LOC102550128103426725634268812Rat
7694663LOC102556395uncharacterized LOC102556395108273438982743280Rat
7752480LOC102555634interferon-inducible GTPase 1-like104361655743621238Rat
7752971LOC102554974uncharacterized LOC102554974105365981553662423Rat
7672755LOC102555877uncharacterized LOC102555877101708766217089470Rat
7673189LOC102555366cofilin-1-like105656075356561878Rat
7695947LOC102555032uncharacterized LOC102555032103302970133057518Rat
7676861LOC102548703probable serine/threonine-protein kinase drkD-like105885251758873907Rat
7677171LOC102552014uncharacterized LOC102552014102364347423649858Rat
7677559LOC102546482uncharacterized LOC102546482101808936318115197Rat
7678833LOC102546407uncharacterized LOC102546407106336504563426586Rat
7683947LOC102546779uncharacterized LOC102546779105663317356635183Rat
7708757LOC10254701760S ribosomal protein L27a-like106559523165596608Rat
7723636LOC102547955uncharacterized LOC102547955108488130684908038Rat
7687401LOC102555543NACHT, LRR and PYD domains-containing protein 1-like105787827757935804Rat
7724887LOC102548148ras-related protein Rab-11A-like108779237187793080Rat
7687952LOC102553218uncharacterized LOC102553218104225862742272145Rat
7688264LOC102554043F-box only protein 5-like106217203162176020Rat
7688399LOC10255162160S ribosomal protein L17-like104008839740089871Rat
7725831LOC102548512uncharacterized LOC102548512103778477137796185Rat
7688718LOC102555300uncharacterized LOC102555300107102816471033059Rat
7730917LOC102547488uncharacterized LOC102547488102750428327547717Rat
7736940LOC10255230160S ribosomal protein L10-like103870979338711383Rat
7737472LOC102550895uncharacterized LOC102550895103912048739194004Rat
7712989LOC102548961uncharacterized LOC102548961103803427238054240Rat
7738405LOC102550422uncharacterized LOC102550422103015263130155894Rat
7738418LOC102549389sarcoplasmic/endoplasmic reticulum calcium ATPase 3-like106234518662351166Rat
7714184LOC102552171heat shock protein 75 kDa, mitochondrial-like101159217411594874Rat
7714490LOC102549660uncharacterized LOC102549660102978464129798720Rat
7732573LOC102547782uncharacterized LOC102547782103496160434962307Rat
7738523LOC102555216uncharacterized LOC102555216105375258353778284Rat
7739209LOC102546363uncharacterized LOC102546363104573205145750872Rat
7736805LOC102548300uncharacterized LOC102548300101493749614941523Rat
7739848LOC102551940uncharacterized LOC102551940101201278212020119Rat
7716133LOC10255545540S ribosomal protein S19-like103583815935838597Rat
7668130LOC102546327uncharacterized LOC102546327108288794382900556Rat
7668412LOC102552371uncharacterized LOC102552371106665175966655307Rat
7668824LOC102550169uncharacterized LOC102550169108382435083825345Rat
7698217LOC102550265uncharacterized LOC102550265107768794177719505Rat
7718036LOC102550484uncharacterized LOC102550484104716540647168440Rat
7670669LOC10255045360S ribosomal protein L3-like101544835915449858Rat
7744446LOC102552546uncharacterized LOC102552546104139653741399566Rat
7744495LOC102556493non-histone chromosomal protein HMG-14-like106342805263432325Rat
7699687LOC10254889440S ribosomal protein S27-like105938765159389231Rat
7719175LOC102553715microfibril-associated glycoprotein 4-like104900091449003935Rat
7671502LOC102546821uncharacterized LOC102546821103708482537087490Rat
7720100LOC102553066uncharacterized LOC102553066104943358149466324Rat
7720537LOC102553586uncharacterized LOC102553586104310915443115115Rat
7720886LOC102547016uncharacterized LOC102547016104613350546136923Rat
7701476LOC102547579uncharacterized LOC102547579105832488058330561Rat
7721705LOC102549226protein TIME FOR COFFEE-like107604029676049235Rat
7702025Krtap29-1keratin associated protein 29-1108789026687891285Rat
7722794LOC102548674uncharacterized LOC102548674108602551186030408Rat
7675325LOC10254918360S ribosomal protein L7a-like101538720915388671Rat
7703088LOC102548331uncharacterized LOC102548331108554199185548716Rat
7727790LOC102551165uncharacterized LOC102551165108442234484422907Rat
7679001LOC102555637epsin-3-like108221484082216538Rat
7679467LOC102550742uncharacterized LOC102550742103076673030898285Rat
7748685LOC102555921interferon-induced transmembrane protein 1-like107434715574348968Rat
7748686LOC102555947centrobin-like105602043556023274Rat
7728583LOC102547722uncharacterized LOC102547722102512013825143846Rat
7679913LOC102555823uncharacterized LOC102555823108187319281884770Rat
7749619LOC102554873uncharacterized LOC102554873101316347313166126Rat
7750038LOC10255116260S ribosomal protein L35-like101329788813298249Rat
7710009LOC102555689uncharacterized LOC102555689103596827835972662Rat
7729046LOC10255524360S ribosomal protein L29-like103525987735260396Rat
7711413LOC102555855uncharacterized LOC102555855107652550876526460Rat
7681934LOC102553978uncharacterized LOC102553978106212622762127171Rat
9128457LOC103693394GTPase Era, mitochondrial-like106528136865282931Rat
9129118LOC103693320uncharacterized LOC103693320103595471235966160Rat
9129129LOC103693386uncharacterized LOC103693386106290999662911451Rat
9129706LOC103693351uncharacterized LOC103693351105386882653873269Rat
9131446LOC103689927protein RMD5 homolog B103707358837084671Rat
9131471LOC103693353uncharacterized LOC103693353105491443154915445Rat
9131478LOC103693416uncharacterized LOC103693416107784973377865871Rat
9132754LOC103693309uncharacterized LOC103693309102985342229874069Rat
9133343LOC103693348uncharacterized LOC103693348105218853152194930Rat
9134175LOC103693346THAP domain-containing protein 5-like105226487652265170Rat
9091072LOC103693306prohibitin pseudogene102540381325404219Rat
9092884LOC103693388uncharacterized LOC103693388106347413563476526Rat
9135016LOC103693308protein phosphatase 1 regulatory subunit 14A pseudogene102930962429316206Rat
9095316LOC10369330760S ribosomal protein L22-like 1 pseudogene102581358025820390Rat
9174117LOC103693389breakpoint cluster region protein-like106355207963601952Rat
9174727Cox11cytochrome c oxidase copper chaperone COX11107816869178173845Rat
9174727Cox11cytochrome c oxidase copper chaperone COX11107810262078174584Rat
9097026LOC103693295uncharacterized LOC103693295101783278117834132Rat
9177822LOC103690259olfactory receptor 2AK2-like104442068444421593Rat
9099309LOC103693342uncharacterized LOC103693342104766706947678164Rat
9075755LOC103693303uncharacterized LOC103693303102622267726262529Rat
9146354LOC103693369up-regulated during skeletal muscle growth protein 5 pseudogene105399053653998872Rat
9180709LOC103693460uncharacterized LOC103693460109169462591702510Rat
9183390LOC103693347THAP domain-containing protein 5-like105226350552264435Rat
9103394LOC103693359uncharacterized LOC103693359105846746858469910Rat
9104895LOC1036901645-phosphohydroxy-L-lysine phospho-lyase103703203537054347Rat
9184441LOC103693339uncharacterized LOC103693339104573801645743953Rat
9153013LOC103693337olfactory receptor 2W3-like104461599044619909Rat
9105568LOC103693396uncharacterized LOC103693396106571265965720185Rat
9106651LOC103693294uncharacterized LOC103693294101697398516975410Rat
9187180LOC103693455uncharacterized LOC103693455108951130689527240Rat
9187953LOC103693453skin secretory protein xP2-like108392112283933725Rat
9188304LOC103693274uncharacterized LOC103693274101128777911292138Rat
9156678Gsg1l2GSG1-like 2105432720854344318Rat
9190675LOC103693331uncharacterized LOC103693331104340810943416666Rat
9158006LOC103693398uncharacterized LOC103693398106662959966636640Rat
9158343LOC10369344160S ribosomal protein L27a pseudogene106521665765217096Rat
9112386LOC103693435uncharacterized LOC103693435109043081690431350Rat
9195063LOC103693357uncharacterized LOC103693357105641240456419898Rat
9196653LOC103690286olfactory receptor 2T29-like104417408644175033Rat
9114957LOC103693363olfactory receptor 1468-like106000028160006037Rat
9116498LOC103693429uncharacterized LOC103693429108772359287728562Rat
9197903LOC103693350uncharacterized LOC103693350105366957153687763Rat
9163874LOC103693433uncharacterized LOC103693433108946447889467145Rat
9164790LOC103693366THAP domain-containing protein 5-like105226449552264886Rat
9119561LOC103693360uncharacterized LOC103693360105854732658552821Rat
9200145LOC103693289uncharacterized LOC103693289101411201814115875Rat
9200412LOC103693324uncharacterized LOC103693324103696608537004832Rat
9120365LOC103693446uncharacterized LOC103693446107186276071868132Rat
9203006LOC103693430up-regulated during skeletal muscle growth protein 5108918716289187504Rat
9204599LOC103693454tubulin polyglutamylase TTLL6-like108395397083964266Rat
9170104LOC103693367myosin-13105387308953920698Rat
9124582LOC103693352uncharacterized LOC103693352105385334753859868Rat
9205218LOC103689924olfactory receptor 1361-like101226820112268756Rat
9082358LOC103693417uncharacterized LOC103693417107782963677840530Rat
9084586C10H17orf102chromosome 10 open reading frame, human C17orf102106973511669737570Rat
9085314LOC103693400uncharacterized LOC103693400106723430467238513Rat
9348758LOC103690280olfactory receptor 2AK2-like104445807744459012Rat
9350506LOC103690212uncharacterized LOC103690212101188898711891153Rat
9221572LOC103689920uncharacterized LOC103689920103504485035054160Rat
9221598LOC103693356uncharacterized LOC103693356105625990656260359Rat
9221945LOC103693387uncharacterized LOC103693387106339671363412609Rat
9353394LOC10369344860S ribosomal protein L36-like107637281676373460Rat
9310824LOC103693323collagen alpha-1(XXIII) chain103674113937031200Rat
9312095LOC103693393basic salivary proline-rich protein 2-like106502856565044759Rat
9226275LOC103693408uncharacterized LOC103693408107415469374158623Rat
9229044LOC103693362uncharacterized LOC103693362105994171359959359Rat
9273888LOC103695098uncharacterized LOC103695098105857912558582593Rat
9313909LOC103693329uncharacterized LOC103693329104307022343074845Rat
9313918LOC103693354uncharacterized LOC103693354105570557055708119Rat
9277126LOC103693405uncharacterized LOC103693405107076662270775207Rat
9277135LOC103693415uncharacterized LOC103693415107755015477578041Rat
9315631LOC103693297uncharacterized LOC103693297101896749718995942Rat
9231942LOC103693399uncharacterized LOC103693399106692338066927135Rat
9233226LOC103693328uncharacterized LOC103693328104183536341866068Rat
9233680LOC103693332uncharacterized LOC103693332104414778544149990Rat
9277648LOC103693414uncharacterized LOC103693414107639006476391510Rat
9278651LOC103693401uncharacterized LOC103693401106895348768957745Rat
9384463LOC103693449ATP synthase-coupling factor 6, mitochondrial pseudogene108136602981366504Rat
9235506LOC103693397NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4 pseudogene106594036765946902Rat
9236915LOC103693447cancer/testis antigen 55 pseudogene107469026674690721Rat
9280408LOC103693421uncharacterized LOC103693421108183263381842635Rat
9281539LOC103693330up-regulated during skeletal muscle growth protein 5 pseudogene104346527743465658Rat
9322757LOC103693349uncharacterized LOC103693349105365706853669531Rat
9241102LOC103693412uncharacterized LOC103693412107591087275914878Rat
9283257LOC10369329960S ribosomal protein L34 pseudogene101539811215403096Rat
9283258LOC103693390uncharacterized LOC103693390106377184463788043Rat
9326009LOC103693343thymosin beta-4 pseudogene104889074548891073Rat
9245120LOC103693391uncharacterized LOC103693391106434108264343688Rat
9286067LOC103693322uncharacterized LOC103693322103705529037055993Rat
9287842LOC103693317uncharacterized LOC103693317103131408631316114Rat
9332269LOC103693402uncharacterized LOC103693402106906829969071180Rat
9290621LOC103693406uncharacterized LOC103693406107079044070802668Rat
9359311LOC103693444glyceraldehyde-3-phosphate dehydrogenase-like106917698169185205Rat
9360503LOC103693428uncharacterized LOC103693428108694802086950434Rat
9360911LOC103693368myosin-13-like105391770953920592Rat
9378865LOC103693456uncharacterized LOC103693456109003780090039526Rat
9379147LOC103695128WAP four-disulfide core domain protein 18-like107092639470928204Rat
9380721LOC103693304uncharacterized LOC103693304102630545126339152Rat
9296482LOC103693327uncharacterized LOC103693327104047231440479098Rat
9338508LOC103693423transmembrane protein 92-like108262821482634598Rat
9339380LOC103693316activated RNA polymerase II transcriptional coactivator p15 pseudogene103112942531129957Rat
9368707LOC103693345THAP domain-containing protein 5-like105226516552266294Rat
9256487LOC103693418uncharacterized LOC103693418107796101977980554Rat
9341147LOC103693385uncharacterized LOC103693385106293667962941780Rat
9341831LOC103693301uncharacterized LOC103693301101609031016095480Rat
9259011LOC103690306schlafen family member 12-like107048202670482726Rat
9259038LOC10369344360S ribosomal protein L12-like106729961767300140Rat
9259835LOC103693410uncharacterized LOC103693410107545321675458252Rat
9302191LOC103693334tripartite motif-containing protein 7-like103418551934187430Rat
9343685LOC103689931heterogeneous nuclear ribonucleoprotein A/B103704940037055348Rat
9261501LOC103693315uncharacterized LOC103693315103054492030555630Rat
9302892LOC103693431uncharacterized LOC103693431108929296489294499Rat
9304230LOC103693395uncharacterized LOC103693395106555416565555793Rat
9344254Percc1proline and glutamate rich with coiled coil 1101452923114531682Rat
9372195LOC103693365ferritin light chain 1 pseudogene104582203445822580Rat
9306084LOC103690411uncharacterized LOC103690411102704733627110304Rat
9463945LOC103695157uncharacterized LOC103695157108734387587347714Rat
9219958LOC103689956dual specificity mitogen-activated protein kinase kinase 3104508940145110803Rat
9317193LOC103693364ATP synthase subunit e, mitochondrial pseudogene106142589761426172Rat
9318017LOC10369330060S ribosomal protein L34 pseudogene101546688215468772Rat
9464522LOC103693452uncharacterized LOC103693452108298762483022154Rat
9330198LOC103693277uncharacterized LOC103693277101157069011582475Rat
9427312LOC103689949nedd4 binding protein 3103709038837099051Rat
9429218LOC103693335olfactory receptor 1L4-like103657929836580312Rat
9392377LOC103693361putative proline-rich protein 21105891338258915869Rat
9393802LOC103693314uncharacterized LOC103693314103035182130359728Rat
9393811LOC103693319uncharacterized LOC103693319103210220732104346Rat
9432514LOC103693407uncharacterized LOC103693407107247186872482995Rat
9473667LOC103693292uncharacterized LOC103693292101560486615609083Rat
9395806LOC103693438glyceraldehyde-3-phosphate dehydrogenase pseudogene107031411170330078Rat
9476429LOC103693450endogenous Bornavirus-like nucleoprotein 2108168687981690966Rat
9397746LOC103693326uncharacterized LOC103693326103756370137569294Rat
9437162LOC103693318uncharacterized LOC103693318103152085031529901Rat
9437651LOC103693293uncharacterized LOC103693293101610615916109579Rat
9438204LOC103693424transmembrane protein 92-like108253521582535912Rat
9444726LOC103693437uncharacterized LOC103693437109075361090757175Rat
9408823LOC103693305uncharacterized LOC103693305102680947726816320Rat
9447800LOC103693451transmembrane protein 92-like108252412582527962Rat
9450974LOC103693436uncharacterized LOC103693436109070115890701493Rat
9452287LOC103693333protein UXT pseudogene104089587040896891Rat
9413039Ptges3lprostaglandin E synthase 3 like108933136889338644Rat
9453438LOC10369333660S ribosomal protein L14 pseudogene103866190138662557Rat
9455331LOC103693392uncharacterized LOC103693392106495739264976332Rat
9455338LOC103693404spindle and kinetochore-associated protein 2 pseudogene107036622370367252Rat
9455339LOC103693426uncharacterized LOC103693426108366874983677535Rat
9456662LOC103693403uncharacterized LOC103693403107012661070129053Rat
9456669LOC103693439disabled homolog 1 pseudogene107237758572379646Rat
9417566LOC103693420thymosin beta-10 pseudogene108145079281451039Rat
9418229LOC103693358uncharacterized LOC103693358105799337258012903Rat
9457470LOC103693344thymosin beta-4 pseudogene104899548048995810Rat
9459675LOC103690013H/ACA ribonucleoprotein complex subunit 2103706938737072758Rat
9460238LOC103693338uncharacterized LOC103693338104507870645089392Rat
9217344LOC103693340uncharacterized LOC103693340104717168447182280Rat
9218351LOC103693413uncharacterized LOC103693413107578489275804907Rat
9219077LOC10369335560S ribosomal protein L35a-like105573664155736954Rat
9420292LOC103693422uncharacterized LOC103693422108307918883086567Rat
9420753LOC10369345960S ribosomal protein L22-like 1 pseudogene109103188791032410Rat
9743990Selenow-ps1selenoprotein W, pseudogene 1104849798648498687Rat
10059729Baiap3BAI1-associated protein 3101460113314613881Rat
11360294LOC108352063uncharacterized LOC108352063101507499815088205Rat
10395317Hoxb5oshomeobox B5 and homeobox B6, opposite strand108413948484155527Rat
11362101LOC108352135uncharacterized LOC108352135108830754488315541Rat
11370322LOC108352225uncharacterized LOC108352225107920452379210808Rat
11371601Trnat-agu2transfer RNA threonine (anticodon AGU) 2105561814455618217Rat
11366402LOC108352183spindle and kinetochore-associated protein 2 pseudogene107034984670367830Rat
11455953LOC108352103uncharacterized LOC108352103105853979458565884Rat
11358390LOC108352211uncharacterized LOC108352211108224881582256481Rat
11446138Trnar-ccu4transfer RNA arginine (anticodon CCU) 4101287734612877418Rat
10411933LOC106736471antisense transcript of iNOS gene106476291164763482Rat
11433460LOC108352126dual specificity protein phosphatase 26 pseudogene108529449885297607Rat
11433695LOC108352128uncharacterized LOC108352128108647465386476907Rat
11443179Trnac-gca36transfer RNA cysteine (anticodon GCA) 36108593984585939916Rat
11443407LOC108352110uncharacterized LOC108352110106780955167811287Rat
11454687LOC108352210uncharacterized LOC108352210106865119068652332Rat
11463322LOC108352108uncharacterized LOC108352108106451758264527056Rat
11464159LOC10835217160S ribosomal protein L34 pseudogene101540057115404035Rat
11464160LOC108352220uncharacterized LOC108352220104920119149209823Rat
11462129LOC108352136uncharacterized LOC108352136108866546788669114Rat
11464772LOC10835221840S ribosomal protein S28 pseudogene104076646540766676Rat
11465658LOC108352131uncharacterized LOC108352131108684840886848977Rat
11466692Trnan-guu10transfer RNA asparagine (anticodon GUU) 10108564563885645711Rat
11466937LOC108352202uncharacterized LOC108352202102098813620994272Rat
11467250LOC10835209960S ribosomal protein L21 pseudogene105721039857214388Rat
11467318LOC108352111uncharacterized LOC108352111106807650768089042Rat
11468471Trnat-cgu1transfer RNA threonine (anticodon CGU) 1106705888867058959Rat
11469336LOC108352072uncharacterized LOC108352072102288505623406602Rat
11470817LOC108348235keratin-associated protein 9-1-like108777452787775395Rat
11471077Trnat-ugu1transfer RNA threonine (anticodon UGU) 1103420302834203100Rat
11471289LOC108352080uncharacterized LOC108352080103351747733524847Rat
11472642LOC108352113transcription factor BTF3 homolog 4 pseudogene107008499270086973Rat
11472969Trnai-aau4transfer RNA isoleucine (anticodon AAU) 4102893142328931496Rat
11474460Trnae-cuc5transfer RNA glutamic acid (anticodon CUC) 5104374060943740680Rat
11474710LOC108352223uncharacterized LOC108352223106572243165724569Rat
11475289Trnap-cgg2transfer RNA proline (anticodon CGG) 2105562071855620789Rat
11475921LOC108348055B9 domain-containing protein 1104901974549029851Rat
11435226LOC108352208uncharacterized LOC108352208106934715269362721Rat
11435267Trnap-agg11transfer RNA proline (anticodon AGG) 11101285232512852396Rat
11361296LOC108352209uncharacterized LOC108352209106855285168554998Rat
11361305Trnat-ugu2transfer RNA threonine (anticodon UGU) 2105504757355047645Rat
11361526LOC108348151coronin-7-like101137322511384986Rat
11436072NEWGENE_6497122FLYWCH family member 2101311221513120843Rat
11436409Trnap-ugg4transfer RNA proline (anticodon UGG) 4101287517612875247Rat
11444871Trnas-gcu7transfer RNA serine (anticodon GCU) 7105564533255645413Rat
11445133Trnag-ucc3transfer RNA glycine (anticodon UCC) 3105562171655621787Rat
11445698LOC108352088ferritin light chain 1 pseudogene104582181045822738Rat
11458477LOC108352091uncharacterized LOC108352091104769111347697766Rat
11458838Trnal-uag2transfer RNA leucine (anticodon UAG) 2105571070955710790Rat
11365920LOC108352178surfeit locus protein 6-like103139151731418576Rat
11437253LOC108352058uncharacterized LOC108352058101180837411816843Rat
11437268Trnai-aau6transfer RNA isoleucine (anticodon AAU) 6105564460155644674Rat
11437457LOC10835220760S ribosomal protein L35a pseudogene106858878268589148Rat
11446388LOC108352127uncharacterized LOC108352127108578671685789165Rat
11446395LOC108352129uncharacterized LOC108352129108657523286599028Rat
11446408Trnaw-cca3transfer RNA tryptophan (anticodon CCA) 3104916699249167063Rat
11438209LOC108352114uncharacterized LOC108352114107025807470259199Rat
11447467LOC108352186endogenous Bornavirus-like nucleoprotein 1109169205891694039Rat
11357857Trnak-cuu15transfer RNA lysine (anticodon CUU) 15101287609912876171Rat
11360004LOC108352118uncharacterized LOC108352118107777378877813512Rat
11369295LOC10835207560S ribosomal protein L34 pseudogene102923445329234888Rat
11371335Trnat-agu3transfer RNA threonine (anticodon AGU) 3105564503655645109Rat
11449947LOC108352064uncharacterized LOC108352064101516986615176422Rat
11439070LOC108352199uncharacterized LOC108352199101813187918146614Rat
11450452Trnak-cuu14transfer RNA lysine (anticodon CUU) 14101286116812861240Rat
11450453Trnal-caa1transfer RNA leucine (anticodon CAA) 1104374089943741004Rat
11364143Trnav-aac5transfer RNA valine (anticodon AAC) 5103420616634206238Rat
11451344Trnan-guu9transfer RNA asparagine (anticodon GUU) 9107473571474735787Rat
11451834LOC108352090SRA stem-loop-interacting RNA-binding protein, mitochondrial pseudogene104737233247372762Rat
11451876LOC108352226uncharacterized LOC108352226108745948887465284Rat
11429765LOC108352174leucine-rich repeat-containing protein 37A3-like108951996289523237Rat
11430775LOC108352215uncharacterized LOC108352215102576822225769066Rat
11371850LOC108352123uncharacterized LOC108352123108419228484192880Rat
11372181LOC108348279keratin-associated protein 4-2-like108769463987695384Rat
11460333LOC10835211560S ribosomal protein L30-like107079484470795389Rat
11431432LOC108352061uncharacterized LOC108352061101405618114059342Rat
11432034LOC10835206560S ribosomal protein L36a-like101531823215318622Rat
11452913LOC108352173small nuclear ribonucleoprotein G pseudogene105923429859235392Rat
11453374LOC10835209660S ribosomal protein L30-like105530330055303780Rat
11453375LOC108352197fibropellin-1-like101860044218609368Rat
11081198LOC287274sedlin-like103713023437134976Rat
11383644Trnac-gca35transfer RNA cysteine (anticodon GCA) 35108574387485743945Rat
11384018LOC108352132uncharacterized LOC108352132108728283987289426Rat
11394985LOC108352069uncharacterized LOC108352069101685646216861613Rat
11395008Trnak-cuu13transfer RNA lysine (anticodon CUU) 13101285434212854414Rat
11405275LOC108352109pre-mRNA-splicing factor CWC22 homolog106755825367559048Rat
11405522LOC108352102chromobox protein homolog 3 pseudogene105766498057667975Rat
11405523Trnag-ccc5transfer RNA glycine (anticodon CCC) 5101524113815241208Rat
11406143Trnar-ccu6transfer RNA arginine (anticodon CCU) 6108242820682428278Rat
11406617Trnak-cuu12transfer RNA lysine (anticodon CUU) 12101285273812852810Rat
11412314LOC108352068uncharacterized LOC108352068101614177716151152Rat
11412952LOC108352076uncharacterized LOC108352076102945044729462904Rat
11413531LOC108352121uncharacterized LOC108352121108091620680922907Rat
11413702Trnaq-cug6transfer RNA glutamine (anticodon CUG) 6105571107955711150Rat
11415587Trnag-gcc2transfer RNA glycine (anticodon GCC) 2105570555055705620Rat
11417012LOC10835208560S ribosomal protein L17 pseudogene104008877340091882Rat
11421503LOC10835221760S ribosomal protein L17 pseudogene103410506534105689Rat
11421730LOC108352078uncharacterized LOC108352078102961089629632531Rat
11424155LOC108352204uncharacterized LOC108352204102109440021100746Rat
11359066LOC108352082uncharacterized LOC108352082103518735035191033Rat
11427237Trnav-aac4transfer RNA valine (anticodon AAC) 4103417440334174475Rat
11427364Trnak-cuu16transfer RNA lysine (anticodon CUU) 16103418216934182241Rat
11395747LOC108352122uncharacterized LOC108352122108118887981208687Rat
11396808LOC108352074uncharacterized LOC108352074102910479329110099Rat
11406992LOC108352214uncharacterized LOC108352214101621190316213186Rat
11407074LOC108352095glyceraldehyde-3-phosphate dehydrogenase pseudogene105520491355205397Rat
11407955LOC108352086uncharacterized LOC108352086104367377843680906Rat
11385134Trnal-aag3transfer RNA leucine (anticodon AAG) 3103420653434206615Rat
11385993LOC108352104uncharacterized LOC108352104105888515558888390Rat
11386002Trnad-guc3transfer RNA aspartic acid (anticodon GUC) 3105562128755621358Rat
11397104LOC108352070uncharacterized LOC108352070101971806719766305Rat
11375109LOC108352097protein transport protein Sec61 subunit gamma pseudogene105668485356685118Rat
11375592LOC108352184transmembrane protein 92-like108265674182660573Rat
11386799Trnar-ccg1transfer RNA arginine (anticodon CCG) 1101287920712879279Rat
11376555Trnac-gca34transfer RNA cysteine (anticodon GCA) 34108574215585742226Rat
11409205LOC108352060uncharacterized LOC108352060101322110513226726Rat
11387328LOC108352198uncharacterized LOC108352198101849962318561133Rat
11398916LOC108352073uncharacterized LOC108352073102480090325011815Rat
11410913LOC108352062uncharacterized LOC108352062101480595614811189Rat
11388507Trnap-ugg5transfer RNA proline (anticodon UGG) 5103420579934205870Rat
11388508Trnap-agg12transfer RNA proline (anticodon AGG) 12101285728412857355Rat
11389050LOC108348082dual specificity mitogen-activated protein kinase kinase 3-like104718236447203781Rat
11400509Trnai-aau5transfer RNA isoleucine (anticodon AAU) 5105561729955617372Rat
11401048LOC108352098uncharacterized LOC108352098105681943556825534Rat
11401057LOC10835212060S ribosomal protein L35 pseudogene107841662278418173Rat
11378347LOC108352094uncharacterized LOC108352094105124197151333800Rat
11411023Trnac-gca37transfer RNA cysteine (anticodon GCA) 37108594051785940588Rat
11411272C10H5orf58chromosome 10 open reading frame, human C5orf58101904337419052918Rat
11411642Trnaa-ugc2transfer RNA alanine (anticodon UGC) 2103418265034182721Rat
11402118LOC108352077uncharacterized LOC108352077102939036929392857Rat
11402125LOC108352138uncharacterized LOC108352138109033849190341933Rat
11402134Trnap-cgg1transfer RNA proline (anticodon CGG) 1101286098812861059Rat
11390972LOC108352181nitric oxide synthase, inducible-like106478398864786814Rat
11391170LOC108352206uncharacterized LOC108352206103241841632424986Rat
11391314Trnac-gca33transfer RNA cysteine (anticodon GCA) 33108571185985711930Rat
11391494LOC108352107uncharacterized LOC108352107106438045164391765Rat
11402473LOC108352182predicted GPI-anchored protein 58106786155367862077Rat
11402890LOC108352083uncharacterized LOC108352083103851266638538171Rat
11381197LOC108352101uncharacterized LOC108352101105758330957586993Rat
11381211LOC108352221olfactory receptor 1468-like106236510362366044Rat
11392345Trnaq-uug1transfer RNA glutamine (anticodon UUG) 1108367204983672120Rat
11393182LOC108348219uncharacterized LOC108348219103795490437967294Rat
11393223LOC108352116uncharacterized LOC108352116107372370473725594Rat
11404353Trnas-aga4transfer RNA serine (anticodon AGA) 4105561777355617854Rat
11382930LOC108352117uncharacterized LOC108352117107605475676063970Rat
11383084LOC108352067uncharacterized LOC108352067101578786415793452Rat
11383214LOC108352124uncharacterized LOC108352124108492908484935686Rat
11383223LOC10835217740S ribosomal protein S25 pseudogene101331300413313400Rat
11393461LOC108348032olfactory receptor 1106236101962361963Rat
11393487Trnas-cga2transfer RNA serine (anticodon CGA) 2105569753855697619Rat
11519998Trnav-cac2transfer RNA valine (anticodon CAC) 2103416782634167898Rat
11476401LOC108352066uncharacterized LOC108352066101553621415538867Rat
11501653LOC108352205uncharacterized LOC108352205102189649721897045Rat
11501755LOC108352093uncharacterized LOC108352093104958263649621776Rat
11505532Trnar-ucu4transfer RNA arginine (anticodon UCU) 4105571010755710193Rat
11505801Trnaw-cca4transfer RNA tryptophan (anticodon CCA) 4105562227455622345Rat
11506664LOC108352219uncharacterized LOC108352219104770664247708174Rat
11507030LOC108352134uncharacterized LOC108352134108807605888082835Rat
11507590LOC108352133uncharacterized LOC108352133108740295887433194Rat
11508066LOC108352180proline-rich extensin-like protein EPR1104382898543830406Rat
11509389LOC108352071uncharacterized LOC108352071101976905519774170Rat
11497110Trnak-uuu4transfer RNA lysine (anticodon UUU) 4105571163655711708Rat
11509915LOC108352201uncharacterized LOC108352201101990454619924260Rat
11510400LOC108352172spindle and kinetochore-associated protein 2 pseudogene101843092118431954Rat
11512098LOC108352216uncharacterized LOC108352216102739737127411453Rat
11499216C10H10orf95chromosome 10 open reading frame, human C10orf95108508538785086085Rat
11499332LOC108352125uncharacterized LOC108352125108523345185237083Rat
11499743Trnat-agu4transfer RNA threonine (anticodon AGU) 4105569704655697119Rat
11499900LOC108352084uncharacterized LOC108352084103989404839896704Rat
11512400LOC108352119uncharacterized LOC108352119107804980778051704Rat
11494898Trnap-ugg3transfer RNA proline (anticodon UGG) 3101285838212858453Rat
11475987Trnaw-cca5transfer RNA tryptophan (anticodon CCA) 5105564581155645882Rat
11482918LOC108352106uncharacterized LOC108352106106203619362054599Rat
11482925LOC10835213960S ribosomal protein L36 pseudogene109051717890517558Rat
11514546LOC108352203uncharacterized LOC108352203102092910320939172Rat
11485485LOC108352079uncharacterized LOC108352079102978605629798032Rat
11485490LOC108352092uncharacterized LOC108352092104833634148341574Rat
11485617LOC108352130uncharacterized LOC108352130108669694886705789Rat
11486590LOC108352105uncharacterized LOC108352105105972194159725259Rat
11487211LOC108352224proline-rich receptor-like protein kinase PERK9106729664867298057Rat
11518329LOC108352100uncharacterized LOC108352100105741201057424708Rat
11488308LOC108352222uncharacterized LOC108352222106329827263309949Rat
11489283LOC108352137uncharacterized LOC108352137108975002789754374Rat
11489702LOC108352089glyceraldehyde-3-phosphate dehydrogenase pseudogene104671075546713183Rat
11492496Trnar-ccu3transfer RNA arginine (anticodon CCU) 3101284984712849919Rat
11492721LOC108352081heterogeneous nuclear ribonucleoprotein A3 pseudogene103421558634217758Rat
11493017LOC108352112uncharacterized LOC108352112106946183869470696Rat
11493377LOC108352087obscurin-like104533800545351661Rat
11493649Trnaw-cca2transfer RNA tryptophan (anticodon CCA) 2104769034447690415Rat
11493989LOC10835217940S ribosomal protein S28 pseudogene103506568035065945Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7387235Uae41Urinary albumin excretion QTL 415.260.1874urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)10129592136Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135538813Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138594330Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142669970Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)10144902893Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1076442166221621Rat
1576304Schws7Schwannoma susceptibility QTL 70.0115nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)10483563820170031Rat
631828Alc5Alcohol consumption QTL 52.4consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10521719917555534Rat
737820Alc9Alcohol consumption QTL 92.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)10521719919591669Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)10546011921524070Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10546011921524070Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10546011921524070Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10546011921524070Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10546011921524070Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10587753664401490Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10622909575983805Rat
631660Hcar1Hepatocarcinoma resistance QTL 13.40.0001liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)10622928936185929Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10642907599492409Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10752145052521450Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101263951357639513Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101482789492423564Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101537547462469074Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101646873661468736Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
737823Alc12Alcohol consumption QTL 124.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)101755538619743866Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101824639453637634Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101940281464402814Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101995869621524070Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101995869621524070Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)1020170031102897474Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102152390683549467Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)12152390690312401Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102152390690312401Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102170776664648311Rat
631531Iresp2Immunoglobin response QTL26.3blood immunoglobulin E amount (VT:0002492)serum total immunoglobulin E level (CMO:0001542)102240281738204229Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102290149793886300Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102386101566539843Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102488408447487910Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102723753064648311Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)1027237530101482600Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1027237530102427718Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102878928073789280Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)103002135454057745Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103098380575983805Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103191939778343192Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103317903078179030Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103334319278343192Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103513942480139424Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566946546851407Rat
2298480Eau7Experimental allergic uveoretinitis QTL 70.0049uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566957336185929Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103618592982675365Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103618592995845311Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103658437353645194Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103658437366539843Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103658456066015527Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)104051404485514044Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)104051404485514044Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1041260363106105607Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1041260363107857673Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104318865981042642Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1043289657108540162Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104370495588704955Rat
11528628Bss116Bone structure and strength QTL 1166.460.00000038femur morphology trait (VT:0000559)femur length (CMO:0000442)104511428345744081Rat
11528631Bss117Bone structure and strength QTL 1176.410.000000389femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)104651052546995276Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104659302198939209Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104684834691848346Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104684834691848346Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104684834691848346Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)105063833795638337Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)105128920384596393Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)105128920384596393Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)105128920384596393Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)105128920384596393Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)105128920384596393Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105310471898104718Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1053621375112626471Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1053621375112626471Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105362581598939209Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105363748594807701Rat
1578762Toxo1Toxoplasma gondii resistance QTL 1brain integrity trait (VT:0010579)percentage of study population displaying Toxoplasma gondii brain cysts at a point in time (CMO:0002028)105405761661300905Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)1055224855100224855Rat
1354585Eae18aExperimental allergic encephalomyelitis QTL 18a7.50.0004nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)105567897660404791Rat
2306787Ean3Experimental allergic neuritis QTL 33.1nervous system integrity trait (VT:0010566)body weight loss (CMO:0001399)105567897669385767Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1055678976112626471Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)1055679084102427604Rat
631652Bp106Blood pressure QTL 106arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)105621187956219861Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1056698730101698730Rat
2298495Eae23Experimental allergic encephalomyelitis QTL 2316.93nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)105718065363976874Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1060450007105450007Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1060875260105875260Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1060875260105875260Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1060875260105875260Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1062096293107096293Rat
1331839Eae18bExperimental allergic encephalomyelitis QTL 18b5.80.03nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)106455091270202084Rat
70363Bp71Blood pressure QTL 710.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106464817584601269Rat
2306970Anxrr22Anxiety related response QTL 225.95fear/anxiety-related behavior trait (VT:1000241)number of periods of voluntary immobility (CMO:0001045)1064648175101691360Rat
1558643Cm44Cardiac mass QTL 444.80.0000368heart mass (VT:0007028)heart wet weight (CMO:0000069)1064648175102149713Rat
6893336Cm75Cardiac mass QTL 750.10.87heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1064648175102149713Rat
631526Bp76Blood pressure QTL 760.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106464831169123603Rat
61402Niddm3Non-insulin dependent diabetes mellitus QTL 34.58blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)106464831185513822Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1065590122110590122Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1065992275110992275Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1065992275110992275Rat
7387312Bw125Body weight QTL 12530.0047retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight (CMO:0000356)1067880046112626471Rat
1581559Eae18Experimental allergic encephalomyelitis QTL 180.00002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1067988218110992091Rat
2298481Eau9Experimental allergic uveoretinitis QTL 90.0169uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)106830503785514044Rat
2301405Cm69Cardiac mass QTL 690.031heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)106869792870167191Rat
11565453Kidm58Kidney mass QTL 580.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)106869792870167191Rat
12903252Cm113Cardiac mass QTL 1130.047heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)106869792870167191Rat
12903266Cm114Cardiac mass QTL 1140.02heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)106869792870167191Rat
12903269Am15Aortic mass QTL 150.042aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)106869792870167191Rat
12880370Cm105Cardiac mass QTL 1050.008heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)106869792870581793Rat
12880371Cm106Cardiac mass QTL 1060.007heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)106869792870581793Rat
12880372Am12Aortic mass QTL 120.003aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)106869792870581793Rat
12880375Kidm66Kidney mass QTL 660.009kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)106869792870581793Rat
1357344Bp249Blood pressure QTL 2490.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1069123603101482600Rat
631565Hcuc4Hepatic copper content QTL 44.15hepatic copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)106934845975983662Rat
8657410Bp374Blood pressure QTL 374heart left ventricle size trait (VT:0002753)heart left ventricular end-diastolic diameter (CMO:0000982)106938559570167191Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1069385595112626471Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1069385595112626471Rat
1579917Bp282Blood pressure QTL 2820.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106980879370581793Rat
2289985Bp305Blood pressure QTL 305arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106991083276109716Rat
2292440Bp312Blood pressure QTL 312arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107016696070581793Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1070166960112626471Rat
1642290Bp299Blood pressure QTL 299arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)107064708971727943Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1070800069112626471Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1071692298112626471Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1073008136112626471Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1073008136112626471Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1073008136112626471Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1073467158112626471Rat
2292439Bp309Blood pressure QTL 309arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107372791774459500Rat
10450500Bp385Blood pressure QTL 3850.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107372791774459500Rat
1579918Bp279Blood pressure QTL 2790.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107372791775099909Rat
12903245Cm110Cardiac mass QTL 1100.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)107372791775099909Rat
12903246Cm111Cardiac mass QTL 1110.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)107372791775099909Rat
12903247Cm112Cardiac mass QTL 1120.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)107372791775099909Rat
12903248Am14Aortic mass QTL 140.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)107372791775099909Rat
12903249Kidm68Kidney mass QTL 680.02kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)107372791775099909Rat
12902615Bw185Body weight QTL 1850.01body mass (VT:0001259)body weight (CMO:0000012)107372791775099909Rat
2306793Ean5Experimental allergic neuritis QTL 54.7nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)107504539197308358Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1075544754112626471Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1075544754112626471Rat
2289982Bp303Blood pressure QTL 303arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)107598366278343192Rat
724555Bp150Blood pressure QTL 1500.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107598366280946110Rat
12880053Cm104Cardiac mass QTL 1040.009heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)107598366286419171Rat
1358188Ept9Estrogen-induced pituitary tumorigenesis QTL 93.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107598380599492217Rat
2292617Ept18Estrogen-induced pituitary tumorigenesis QTL 183.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107598380599492217Rat
2289983Bp304Blood pressure QTL 304arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)107610949176802057Rat
12880050Am10Aortic mass QTL 100.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)107705574186962563Rat
1579919Bp281Blood pressure QTL 2810.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107705574198282519Rat
631537Oia4Oil induced arthritis QTL 4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)107834302790042115Rat
2325836Bp346Blood pressure QTL 3460.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107897027986962563Rat
10450495Bp383Blood pressure QTL 3830.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107897027998282519Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1078970279112626471Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1079927661112626471Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1080239190112626471Rat
724516Uae17Urinary albumin excretion QTL 173.6urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)108094611088200662Rat
1300107Rf18Renal function QTL 183.41urine output (VT:0003620)timed urine volume (CMO:0000260)1081515116101758478Rat
1358915Stresp7Stress response QTL 73.52blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)108164977590297007Rat
634354Rends3Renal damage susceptibility QTL 30.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)108267523388141097Rat
631555Bp134Blood pressure QTL 1340.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)108338982894488181Rat
6893357Bw102Body weight QTL 1020.50.36body mass (VT:0001259)body weight (CMO:0000012)1083389828104994768Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1085079943112626471Rat
4889948Bss91Bone structure and strength QTL 914tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)108551382295638337Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1086566908112626471Rat
2301398Kidm38Kidney mass QTL 380.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)108696256399303173Rat
12880055Am11Aortic mass QTL 110.004aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)108696256399303173Rat
2306792Ean4Experimental allergic neuritis QTL 44nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)108697786197308569Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1088544136107545372Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1090041957112626471Rat
2313856Bp342Blood pressure QTL 3424.40.0001life span trait (VT:0005372)age at time of death (CMO:0001193)109029689799492409Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1090296897112626471Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)109154814599492409Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1091689348112626471Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 287065 UniSTS
  64154 UniSTS
  679907 UniSTS
UniGene Rn.144694 UniSTS
  Rn.198331 UniSTS
UniSTS 180028 UniSTS