RH133447 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133447

Symbol: RH133447
Also known as: AI030256; 
RGD ID: 5026766
Expected Size: 207 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.015103,369,395 - 103,369,601NCBIRnor6.0
Rnor_5.015106,807,921 - 106,808,127UniSTSRnor5.0
RGSC_v3.415102,956,599 - 102,956,805UniSTSRGSC3.4
Celera1594,076,840 - 94,077,046UniSTS
RH 3.4 Map15651.5UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCAGTTCAATGAGTGGCTGGTT
Reverse Primer CCCTCAGATAATGCCTTTGAAAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359193Gpr180G protein-coupled receptor 18015103340387103369633Rat

Nucleotide Sequences
GenBank Nucleotide CH473951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1526381041106550657Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1526381041106550657Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1526381041106550657Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1543097470106550657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)1561447766106447766Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1565520564110520564Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1575527634111246239Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1575761024109400896Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)1581255292109133904Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1583947714111246239Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1584050550111246239Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1584050550111246239Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1589640684106550657Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)1589640684106550657Rat
1581519Cm59Cardiac mass QTL 592.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)1596777066104003672Rat


Additional Information

Database Acc Id Source(s)
UniSTS 216730 UniSTS