RH133395 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133395

Symbol: RH133395
Previously known as: AA925604; 
RGD ID: 5026752
Expected Size: 218 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2103,820,811 - 3,821,029 (+)MAPPERmRatBN7.2
Rnor_6.0103,774,649 - 3,774,866NCBIRnor6.0
Rnor_5.0102,643,189 - 2,643,406UniSTSRnor5.0
RGSC_v3.4103,698,038 - 3,698,255UniSTSRGSC3.4
Celera102,853,298 - 2,853,515UniSTS
RH 3.4 Map1046.0UniSTS
Cytogenetic Map10q11UniSTS
Is Marker For: Genes:   Cpped1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCTTGTGCTTCCTAACAATGAGC
Reverse Primer GCAGACTGGGAAATCTGAAACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306568Cpped1calcineurin-like phosphoesterase domain containing 11037015223821050Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10124158324Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
1549898Neuinf3Neuroinflammation QTL 326.4nervous system integrity trait (VT:0010566)MHC Class II RT1A-positive spinal cord ventral horn area to total spinal cord ventral horn area ratio (CMO:0001980)1034063205387112Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 302890 UniSTS
UniSTS 216678 UniSTS