RH132649 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH132649

Symbol: RH132649
Previously known as: AI556337; 
RGD ID: 5026552
Expected Size: 180 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X58,804,973 - 58,805,153 (+)MAPPERmRatBN7.2
Rnor_6.0X63,158,652 - 63,158,831NCBIRnor6.0
Rnor_5.0X63,750,063 - 63,750,242UniSTSRnor5.0
RGSC_v3.4X81,429,886 - 81,430,065UniSTSRGSC3.4
CeleraX59,240,572 - 59,240,751UniSTS
Cytogenetic MapXq31UniSTS
Is Marker For: Genes:   Zfx  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTTCCTGTGTTTGAGGAATGC
Reverse Primer AGCAGATAGTGATGGCACAGTGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562664Zfxzinc finger protein X-linkedX5880469058853155Rat

Nucleotide Sequences
GenBank Nucleotide JH619952.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
70221Bp56Blood pressure QTL 564.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X5704214165612192Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 367832 UniSTS
UniSTS 215932 UniSTS