RH131081 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH131081

Symbol: RH131081
Also known as: AI058435; 
RGD ID: 5026144
Expected Size: 220 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0329,410,484 - 29,410,702NCBIRnor6.0
Rnor_6.0316,497,272 - 16,497,491NCBIRnor6.0
Rnor_5.0321,794,076 - 21,794,295UniSTSRnor5.0
Rnor_5.0334,616,034 - 34,616,252UniSTSRnor5.0
RGSC_v3.44103,644,306 - 103,644,525UniSTSRGSC3.4
RGSC_v3.4325,042,401 - 25,042,619UniSTSRGSC3.4
Celera327,077,172 - 27,077,390UniSTS
Celera315,850,282 - 15,850,501UniSTS
Cytogenetic Map3q12UniSTS
RH 3.4 Map3324.81UniSTS
Is Marker For: Genes:   Gtdc1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGAGCAGCCTGACTCCAAGAAT
Reverse Primer GGACAAACATGGCAGATTCAGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
71076Lhx2LIM homeobox 232262867422658447Rat
71061Kynukynureninase32841692628566939Rat
708460Ppp6cprotein phosphatase 6, catalytic subunit32347812323510959Rat
727779Nek6NIMA-related kinase 632281192722888598Rat
621629Olr414olfactory receptor 41432088232420883259Rat
620468Igkv28immunoglobulin kappa chain variable 28 (V28)31786679417867361Rat
68350Nr5a1nuclear receptor subfamily 5, group A, member 132299890023020441Rat
621135Pdclphosducin-like32160234921609821Rat
620673Strbpspermatid perinuclear RNA binding protein32181768021956988Rat
1304833Rc3h2ring finger and CCCH-type domains 232162197621676789Rat
1303007Rpl35ribosomal protein L3532329481323297774Rat
621093Psmb7proteasome 20S subunit beta 732289007222951718Rat
1306007Zbtb6zinc finger and BTB domain containing 632167918121697532Rat
1308561Zbtb26zinc finger and BTB domain containing 2632168533921697945Rat
1304691Rabgap1RAB GTPase activating protein 132169803221815383Rat
1333496Olr418olfactory receptor 41832098164620982578Rat
1333103Olr417olfactory receptor 41732096575120966704Rat
1333332Olr429olfactory receptor 42932129202621292955Rat
1333333Olr425olfactory receptor 42532114794421148897Rat
1333209Olr415olfactory receptor 41532089318720894134Rat
1333868Olr412-psolfactory receptor pseudogene 41232086706520867828Rat
1333139Olr434olfactory receptor 43432136328521364268Rat
1333082Olr413olfactory receptor 41332087870120879639Rat
1332682Olr411olfactory receptor 41132085276720853708Rat
1332944Olr428olfactory receptor 42832127621321277148Rat
1332825Olr427olfactory receptor 42732120860021209523Rat
1311305Golga1golgin A132330931823353439Rat
1332758Olr422olfactory receptor 42232106011721061070Rat
1311651Olfml2aolfactomedin-like 2A32322346823259318Rat
1333411Olr421olfactory receptor 42132102695521027947Rat
1309368Crb2crumbs cell polarity complex component 232203781222061247Rat
1308867Arpc5lactin related protein 2/3 complex, subunit 5-like32330145523309077Rat
1307927Dennd1aDENN domain containing 1A32206112022501502Rat
1306160Lrp1bLDL receptor related protein 1B32520119427348126Rat
1564740Nr6a1nuclear receptor subfamily 6, group A, member 132302922223218050Rat
1561547LOC500180similar to IG KAPPA CHAIN V-V REGION K2 PRECURSOR31929652819297065Rat
1563393Gtdc1glycosyltransferase-like domain containing 132941042629705981Rat
1334355Olr431-psolfactory receptor pseudogene 43132131753721317747Rat
1563231RGD1563231similar to immunoglobulin kappa-chain VK-131699908916999747Rat
1334305Olr416olfactory receptor 41632091366820914603Rat
1359304Arhgap15Rho GTPase activating protein 1532862698729236225Rat
1334437Olr419olfactory receptor 41932099320520994152Rat
1560382RGD1560382similar to [Human Ig rearranged gamma chain mRNA, V_J_C region and complete cds.], gene product31661010116610935Rat
1333656Olr420olfactory receptor 42032101626621017192Rat
1333742Olr424olfactory receptor 42432113050021131492Rat
1334389Olr423olfactory receptor 42332111485621115842Rat
1586383Gpr21G protein-coupled receptor 2132176437721767300Rat
1586003LOC502825hypothetical LOC50282531713926217140655Rat
1586004LOC502823similar to fibrillarin31748061217485807Rat
1587247LOC500184similar to fibrillarin31793813917938911Rat
1564696RGD1564696similar to immunoglobulin light chain variable region31700909717009842Rat
1561137RGD1561137similar to 40S ribosomal protein S1632198388021984383Rat
1584015LOC690155similar to phosducin-like32137368221382128Rat
1584028LOC690140similar to olfactory receptor Olr137432131311621314069Rat
1561736RGD1561736similar to ribosomal protein L1032514852725149104Rat
1562587Wdr38WD repeat domain 3832329171223294818Rat
1582840LOC690273hypothetical protein LOC69027332158122121582267Rat
1588380LOC502622similar to transcription elongation factor B (SIII), polypeptide 232152105321521582Rat
1588381LOC502621similar to transcription elongation factor B (SIII), polypeptide 232151353521513980Rat
1588382LOC502620similar to transcription elongation factor B (SIII), polypeptide 232150916221510009Rat
1588383LOC502619similar to transcription elongation factor B (SIII), polypeptide 232150511121505570Rat
1592210LOC690754similar to fibrillarin31760471317605862Rat
1589739LOC362126similar to Voltage-dependent anion-selective channel protein 2 (VDAC-2) (mVDAC2) (mVDAC6) (Outer mitochondrial membrane protein porin 2)32376254623769677Rat
1588379LOC502623similar to Ribosome biogenesis regulatory protein homolog32144272021450359Rat
1588449LOC498750similar to cDNA sequence BC00553731797971417980319Rat
1590958LOC690876similar to transcription elongation factor B (SIII), polypeptide 232151705421517951Rat
1586005LOC502801hypothetical LOC50280132043607720438415Rat
1589697LOC366036hypothetical LOC36603632358240523583100Rat
1589698LOC366027similar to NME1-NME2 protein32138253721384388Rat
1596103LOC690401hypothetical protein LOC69040132296223122964205Rat
1593416LOC690655similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30)32830710128348346Rat
1594720Scaisuppressor of cancer cell invasion32335758623474218Rat
1591934Klf5-ps2Kruppel-like factor 5, pseudogene 232156450921565435Rat
1592227LOC690737similar to Eukaryotic translation initiation factor 5 (eIF-5)31765792517659531Rat
1597311LOC690381similar to glycosyltransferase-like domain containing 1 isoform b31649816616499499Rat
2318734LOC100362149ribosomal protein S20-like32296422222964734Rat
2318882LOC100365500mCG142154-like31757739417579310Rat
2318320LOC10036236640S ribosomal protein S17-like32460059324601074Rat
2319569LOC100361705rCG64259-like31932029119321014Rat
2319042LOC100365438mCG141619-like31751775517518862Rat
2320327LOC100361338hypothetical LOC10036133831909953219100167Rat
2321310LOC100360848rCG64259-like31657159016572209Rat
2320855LOC100364505hypothetical LOC10036450532032443120330672Rat
2320951LOC100361009rCG64257-like31653675316537430Rat
2323145LOC100363399hypothetical LOC10036339932417253924173279Rat
2323201LOC100363342hypothetical LOC10036334232406603124067420Rat
2321092LOC100360968mCG142527-like31955277319553437Rat
2323358LOC100363282Igk protein-like32030375020304293Rat
2324400LOC100366057rCG53375-like31856215018562681Rat
2324539LOC100362515hypothetical LOC10036251531852570818526227Rat
2323876LOC100359417ubiquinol-cytochrome c reductase subunit32488249524907663Rat
2325335Mir181a2microRNA 181a-232315035223150468Rat
2325454Mir181b2microRNA 181b-232315145523151542Rat
6489735LOC100911937vomeronasal type-2 receptor 26-like31723717617241266Rat
6484475LOC690819Ig kappa chain V19-17-like31709886617099512Rat
6493667LOC100911251disks large homolog 5-like32155439721564309Rat
7539922LOC102551194uncharacterized LOC10255119432778961727972025Rat
7662165LOC102557127histone H3.3-like32160581721606872Rat
7623233LOC102554311uncharacterized LOC10255431132313356523148304Rat
7654995LOC102556236nucleoside diphosphate kinase B-like32160967421613174Rat
7707194LOC102547684uncharacterized LOC10254768432473370324735058Rat
7707315LOC102546322COPII coat assembly protein sec16-like32335355123359951Rat
7684996LOC102554503uncharacterized LOC10255450332302506823031446Rat
7687800LOC102551549uncharacterized LOC10255154932143168921442721Rat
7732175LOC102551298MLV-related proviral Env polyprotein-like32797023327972000Rat
7741314LOC102546443NEDD4-binding protein 1-like32369846623699382Rat
7702504LOC102547849uncharacterized LOC10254784932844449628452127Rat
7749459LOC102554600uncharacterized LOC10255460032325764523272058Rat
9089865LOC103691777uncharacterized LOC10369177732406094224065033Rat
9093487LOC10369180540S ribosomal protein S14 pseudogene32427669524277212Rat
9151592LOC103691776uncharacterized LOC10369177632224572322248080Rat
9224209LOC103691806uncharacterized LOC10369180632649201126496320Rat
9252629LOC103691799Ig kappa chain V-III region MOPC 63-like31721312017217896Rat
9363334LOC103690196transcription factor Sp3 pseudogene32417153824172373Rat
9343709LOC103691775uncharacterized LOC10369177532176922821775540Rat
9343716LOC103691804Ig kappa chain V-V region K2-like32035321220353714Rat
9263023LOC103691774uncharacterized LOC10369177432055265620640189Rat
9307218LOC103691772Ig kappa chain V-V region MOPC 21-like31708725717088015Rat
11051988LOC502818Ig kappa chain V-I region HK102-like31844246318444505Rat
11473570LOC108350366uncharacterized LOC10835036632271607722783722Rat
11458713LOC103691773Ig kappa chain V-V region K2-like31838260718383187Rat
11051991LOC102551297Ig kappa chain V-II region 26-10-like31996119319962116Rat
11051998LOC102554848Ig kappa chain V-V region L7-like31813955318140128Rat
11051987LOC102555123Ig kappa chain V-V region K2-like31843533718436816Rat
11051989LOC102549452Ig kappa chain V-I region HK102-like31941557119421503Rat
11051990LOC102556862Ig kappa chain V-III region MOPC 63-like31824422818244829Rat
11052048LOC102552747Ig kappa chain V-V region K2-like32070748320709432Rat
11052049LOC690813Ig kappa chain V-IV region-like31710759017110056Rat
11431175LOC108350363Ig kappa chain V-V region K2-like32043549020436251Rat
11442316LOC108350579actin, cytoplasmic 2-like32590819325910044Rat
11420073LOC108350364uncharacterized LOC10835036432158293021588062Rat
11425388LOC108350365uncharacterized LOC10835036532168415121695216Rat
11426622LOC108350362uncharacterized LOC10835036231929277119308901Rat
11392125LOC108350552uncharacterized LOC10835055232818763228198156Rat
11383082LOC102556911Ig kappa chain V-V region L7-like31858030218580858Rat
11506214LOC108350368uncharacterized LOC10835036832940283629411320Rat
11496785LOC10835055160S ribosomal protein L12 pseudogene32483716424837883Rat
11497379LOC103691800Ig kappa chain V-IV region-like31734548717346198Rat
11482890LOC108350360rRNA 2'-O-methyltransferase fibrillarin pseudogene31760456117607740Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3125786001Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3128136884Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3128500807Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3132972944Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3137891710Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3139773425Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3263142133477544Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3328592928136884Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3328592928136884Rat
8693641Alc30Alcohol consumption QTL 3020.739drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)3565463925105730Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)3600086634394121Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691441510346Rat
2325840Bp345Blood pressure QTL 3450.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041129084626Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
10450806Scl71Serum cholesterol level QTL 715.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32477298428136884Rat
10450808Scl72Serum cholesterol level QTL 724.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32477298428136884Rat
10450811Scl73Serum cholesterol level QTL 734.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32477298428136884Rat
1298073Cm13Cardiac mass QTL 132.5heart mass (VT:0007028)heart wet weight (CMO:0000069)32563336639248391Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32813672845772990Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32813672851687917Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)32813672851687917Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32813672851687917Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 362129 UniSTS
UniGene Rn.104170 UniSTS
  Rn.177270 UniSTS
UniSTS 214364 UniSTS