RH130736 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: RH130736

Symbol:

RH130736

Previously known as:

AI044091;

RGD ID:

5026056

Expected Size:

207 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	5	75,142,184 - 75,142,391 (+)	MAPPER	mRatBN7.2
mRatBN7.2	5	75,394,151 - 75,394,358 (+)	MAPPER	mRatBN7.2
mRatBN7.2	5	74,842,350 - 74,842,557 (+)	MAPPER	mRatBN7.2
Rnor_6.0	5	77,549,951 - 77,550,157	NCBI	Rnor6.0
Rnor_6.0	5	77,744,252 - 77,744,458	NCBI	Rnor6.0
Rnor_5.0	5	81,870,493 - 81,870,699	UniSTS	Rnor5.0
Rnor_5.0	5	81,680,425 - 81,680,631	UniSTS	Rnor5.0
RH 3.4 Map	5	556.7	UniSTS
Cytogenetic Map	5	q24	UniSTS

Is Marker For:

Genes: Obp3 Mup5 LOC298109 LOC100359580

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GAGCAAGAAATTTGTGCGGAAT
Reverse Primer	ACCAGGACTCCAGCATTACCAT

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
708508	Obp3	alpha-2u globulin PGCL4	5	74842316	74845858	Rat
41369930	Zfp37-ps6	zinc finger protein 37, pseudogene 6	5	74863339	74895596	Rat
708501	Mup4l4	major urinary protein 4 like 4	5	74909468	74912890	Rat
41225436	LOC120102889	major urinary protein-like	5	74917524	75569763	Rat
2323040	Zfp37-ps1	zinc finger protein 37, pseudogene 1	5	74930335	74960075	Rat
735211	Mup4	major urinary protein 4	5	74961143	74964686	Rat
7682781	Zfp37-ps4	zinc finger protein 37, pseudogene 4	5	74978453	74985589	Rat
1583727	Mup18	major urinary protein 18	5	74986813	74990071	Rat
41225607	Mup4-ps6	major urinary protein 4, pseudogene 6	5	75014393	75016663	Rat
6489783	Zfp37-ps3	zinc finger protein 37, pseudogene 3	5	75044021	75200228	Rat
1588799	Mup4-ps7	major urinary protein 4, pseudogene 7	5	75059170	75061471	Rat
9267319	Mup4-ps8	major urinary protein 4, pseudogene 8	5	75142156	75145524	Rat
735107	Mup5	major urinary protein 5	5	75201324	75204903	Rat
41362570	Zfp37-ps5	zinc finger protein 37, pseudogene 5	5	75213049	75221201	Rat
1566134	Mup4l1	major urinary protein 4 like 1	5	75221340	75224797	Rat
41157556	LOC120103071	major urinary protein-like	5	75281520	75283268	Rat
6495515	Zfp37-ps2	zinc finger protein 37, pseudogene 2	5	75301892	75311574	Rat
1593272	Mup4l3	major urinary protein 4 like 3	5	75311713	75316792	Rat
40999109	Mup4-ps4	major urinary protein 4, pseudogene 4	5	75394123	75397484	Rat

Nucleotide Sequences


RefSeq Transcripts	NM_001033958	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001033959	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_147215	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BC086943	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	J00738	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH615093.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH615094.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	X14435	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	X14552	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1331756	Rf34	Renal function QTL 34	4.16275		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	5	1	90450412	Rat
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	1	131345958	Rat
1331771	Rf35	Renal function QTL 35	4.36965		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	5	729470	86724018	Rat
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
7394712	Emca13	Estrogen-induced mammary cancer QTL 13			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	9823266	99753708	Rat
634305	Mamtr1	Mammary tumor resistance QTL 1		0.0001	mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	12789751	113558310	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	31663789	131345958	Rat
1598807	Glom12	Glomerulus QTL 12	2.7		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	5	33215665	78215665	Rat
1298067	Scl15	Serum cholesterol level QTL 15	4.8	0.001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	33215665	78215665	Rat
1302786	Kidm8	Kidney mass QTL 8	28.15		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	33215665	78215665	Rat
1576317	Eutr2	Estrogen induced uterine response QTL 2		0.01	uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	34730116	104251008	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	34944474	113558310	Rat
1641912	Alcrsp18	Alcohol response QTL 18			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	5	35189153	141643988	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	40128307	148607290	Rat
1331773	Scl26	Serum cholesterol level QTL 26	3.065		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	43726656	86724018	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	43726656	129132602	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
1300115	Hrtrt7	Heart rate QTL 7	2.76		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	5	47869062	90099692	Rat
9589025	Epfw7	Epididymal fat weight QTL 7	20.66	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	5	49463600	94463600	Rat
7411561	Bw134	Body weight QTL 134	24	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	49463600	94463600	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	50328551	141643988	Rat
2303615	Vencon7	Ventilatory control QTL 7		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	5	50983895	95983895	Rat
2303574	Gluco42	Glucose level QTL 42	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	53496719	98496719	Rat
61359	Eaex	Experimental allergic encephalomyelitis QTL x	3		nervous system integrity trait (VT:0010566)	post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)	5	55715622	100715622	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55805606	132207589	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	58829236	128034027	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	59793399	143070159	Rat
2316954	Rf57	Renal function QTL 57	0		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	5	59793528	90450144	Rat
2316957	Pur21	Proteinuria QTL 21	6.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	5	59793528	113558156	Rat
61386	Bp49	Blood pressure QTL 49	16.6		cerebrum integrity trait (VT:0010549)	brain infarction volume (CMO:0001013)	5	60293434	98603051	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	64719390	109719390	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	66174080	124160948	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	68984307	104251008	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	68984307	104251008	Rat
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	68984307	104251008	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	69540295	151018848	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100359580	UniSTS
	259247	UniSTS
	298107	UniSTS
	298109	UniSTS
UniSTS	214020	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH130736