RH44825 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH44825

Symbol: RH44825
Previously known as: stSG12505; 
RGD ID: 5017143
Expected Size: 111 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map14q32.33UniSTS
GeneMap99-GB4 RH Map14279.78UniSTS
NCBI RH Map141118.3UniSTS
Is Marker For: Genes:   IGHG2   IGHG1   IGHG3   IGHV4-31   IGHM  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGACAGGGAGAGGCTCTTCT
Reverse Primer AGCAAGCTCACCGTGGAC
 

Region

Nucleotide Sequences
GenBank Nucleotide AB159728 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC195739 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC203608 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC226377 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC239196 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244393 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244396 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244398.3 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244399 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244400 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244410 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244412 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244449 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244450 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244459 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244470 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244487 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244488 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244491 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF027159 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF150959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF237583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF237584 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF237585 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF272774 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF449616 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF449617 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF449618 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF487336 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ001564 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ250170 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ294730 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ294731 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ294732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390235 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390239 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390243 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390244 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390246 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390248 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390250 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390252 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390253 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390254 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390255 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390256 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390257 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390260 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390261 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390263 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390272 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390273 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390274 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390275 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390276 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390277 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390278 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390279 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390280 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390281 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390282 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390283 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ390284 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK057754 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK057775 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK090464 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK092847 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK092976 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK093636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK093806 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097010 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097206 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097306 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097307 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097350 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097354 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097355 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097356 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097357 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097359 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097360 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097361 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097363 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097364 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097365 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097366 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097367 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097572 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097859 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK097950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK098108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK098153 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK098516 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK098817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK123070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK123800 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK123981 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK125632 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK125633 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK126132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK126133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK126281 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK126358 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK127409 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK127415 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128301 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128313 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128394 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128421 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128579 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129508 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129510 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129512 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129514 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129517 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129622 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129637 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129776 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129777 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129787 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129809 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK129812 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130434 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130539 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130577 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130585 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130586 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130589 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130609 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130614 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130642 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130786 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130813 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK130844 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK131045 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK289373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301327 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301332 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301334 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301335 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301358 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301389 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301393 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301403 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK301454 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK303185 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK304469 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL122127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL928742 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL928761 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL954800 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY172957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY172958 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY172959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY372690 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY570731 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY623427 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY869727 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY894992 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC006402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC014258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC014667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC016381 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC018747 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC019046 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC019337 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC024289 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC025314 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC026038 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC031259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC033178 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC037361 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC040042 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC041037 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC051328 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC053984 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC062335 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC062336 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC064496 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC065820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC066642 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC067091 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC069016 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC069020 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC072419 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC073766 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC073773 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC073782 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC073789 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC075840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC075842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC075846 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC078670 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC078671 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC080557 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC089417 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC089421 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC090938 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC090939 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC090940 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092518 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV167498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV167513 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV167545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV176989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV177055 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV177214 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV177215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV177222 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV178873 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV180712 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV199982 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV204145 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV204148 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX538126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX640623 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003461 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471061 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471405.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH882023.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH891419.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH891523.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000265 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000475 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000504 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000676 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001622.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D78345 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486389.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486696.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486948.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS991027.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS991330.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS991559.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EU169674 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FJ200489.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G14654 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G33053 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000116 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL582989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GU179345 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GU997620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HQ186286.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J00228 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J00230 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J00231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976384.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JN222933.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JN582178.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JQ666008.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JQ917464.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JX292761.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JX292762.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JX292763.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JX292764.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KB021645.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M87789 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X03604 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X06766 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X81695 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X81696 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X99549 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y14735 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y14737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z17370 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z49801 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z49802 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 28396 UniSTS
  3500 UniSTS
  3501 UniSTS
  3502 UniSTS
  3507 UniSTS
UniSTS 51616 UniSTS