A001W26 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: A001W26

Symbol: A001W26
Also known as:
RGD ID: 5013056
Expected Size: 162 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381366,011,793 - 66,011,954UniSTSGRCm38
GRCm386100,228,644 - 100,228,805UniSTSGRCm38
MGSCv371366,112,729 - 66,112,890UniSTSGRCm37
MGSCv376100,178,638 - 100,178,799UniSTSGRCm37
Celera6102,093,345 - 102,093,506UniSTS
Celera6102,091,426 - 102,091,587UniSTS
Cytogenetic Map13B3UniSTS
Cytogenetic Map6E1UniSTS
Is Marker For: Genes:   Rybp   Rybp-ps  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAAAGTGGCTTCTAATAACA
Reverse Primer TCATGCTAAAGTGTCAGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1617059Rybp-psRING1 and YY1 binding protein, pseudogene136600764066012021Mouse
1316055RybpRING1 and YY1 binding protein6100228565100287358Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884393Humsd7_mhumerus midshaft diameter 7, 16 week (mouse)13390000075900000Mouse
4142147Mvwf4_mmodifier of von Willebrand factor 4 (mouse)Not determined20293442112761890Mouse
4142009Pregq3_mpregnancy QTL 3 (mouse)Not determined132043134272237070Mouse
1301299Sluc23_msusceptibility to lung cancer 23 (mouse)Not determined133476790768768045Mouse
10412235Scgq5_mspontaneous crescentic glomerulonephritis QTL 5 (mouse)Not determined133587692596102654Mouse
1301734Acsns2_mAngiostrongylus costaricensis nematode susceptibility 2 (mouse)Not determined133594749469947604Mouse
1357587Pfat3_mpredicted fat percentage 3 (mouse)Not determined133594749469947604Mouse
1300561Heal7_mwound healing/regeneration 7 (mouse)Not determined133599078469990868Mouse
1300862Cfbw5_mcystic fibrosis body weight 5 (mouse)Not determined133857254572572704Mouse
1301801Cpfd5_mcerebellum pattern fissures (mouse)Not determined133948143673481584Mouse
1302157Bwem2_mbody weight day 30 males 2 (mouse)Not determined133948143673481584Mouse
1300985Bmd13_mbone mineral density 13 (mouse)Not determined133948143673481584Mouse
15039353Nmrs35_mNAFLD-associated magnetic resonance shift 35 (mouse)134044044074440440Mouse
1300668Pas10_mpulmonary adenoma susceptibility 10 (mouse)Not determined134134122875341344Mouse
4142331Bxs6_mBXSB/MpJ autoimmune nephritis 6 (mouse)Not determined4505696683596627Mouse
10412109Bxs7_mBXSB/MpJ autoimmune nephritis 7 (mouse)Not determined134505696683596627Mouse
26884396Humsd4_mhumerus midshaft diameter 4, 10 week (mouse)134770000073000000Mouse
4142372Moo2_mmodifier of Odc2 (mouse)Not determinedX5017034784170495Mouse
1300916Mobe2_mmodifier of obesity 2 (mouse)Not determined135017034784170495Mouse
1301666Eae13_msusceptibility to experimental allergic encephalomyelitis 13 (mouse)Not determined135017034784170495Mouse
1300573Elsgp2_melevated serum gp70 2 (mouse)Not determined135046870984468908Mouse
14746975Manh74_mmandible shape 74 (mouse)135232915086329150Mouse
1302073Pgct1_mprimordial germ cell tumor locus 1 (mouse)Not determined135367266487672778Mouse
1357563Bmch6_mbone mechanical trait 6 (mouse)Not determined135523686189237021Mouse
4142241Tailq3_mtail length QTL 3 (mouse)Not determined55572541112294569Mouse
4141992W6q16_mweight 6 weeks QTL 16 (mouse)Not determined55572541112294569Mouse
4142314Tailaq3_mtail length adjusted QTL 3 (mouse)Not determined55572541112294569Mouse
4140959W10q17_mweight 10 weeks QTL 17 (mouse)Not determined55572541112294569Mouse
1558850Sgp3_mserum gp70 production 3 (mouse)Not determined135632264376823195Mouse
10402414Sgp5_mserum gp70 production 5 (mouse)Not determined1356322643105285678Mouse
1357553Cia28_mcollagen induced arthritis 28 (mouse)Not determined135648143696102654Mouse
10412163Wra1_mwheel running activity 1 (mouse)Not determined135898448192984619Mouse
1300941Skl6_mskeletal size (tail length) 6 (mouse)Not determined136410270298102826Mouse
1301949Skull20_mskull morphology 20 (mouse)Not determined136410270298102826Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1300704Cia3_mcollagen induced arthritis QTL 3 (mouse)Not determined696347325130347522Mouse
11040599Lmr4b_mleishmaniasis resistance 4b (mouse)696347325130347522Mouse
4141940W6q5_mweight 6 weeks QTL 5 (mouse)Not determined96655951146633626Mouse
4142416Egq11_mearly growth QTL 11 (mouse)Not determined96655951146633626Mouse
1357555Tesq2_mtestis weight QTL 2 (mouse)Not determined696655951146633626Mouse
10043923Bhr7_mbronchial hyperresponsiveness 7 (mouse)Not determined698242853132242977Mouse
1301518Bbaa5_mB.burgdorferi-associated arthritis 5 (mouse)Not determined698506837145935444Mouse
1301923Lith6_mlithogenic gene 6 (mouse)Not determined698717516132717715Mouse
1301915Chab3_mcholesterol absorption 3 (mouse)Not determined698931748132940036Mouse
1302131Bmd8_mbone mineral density 8 (mouse)Not determined699155128133155267Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 56353 UniSTS
  628746 UniSTS
UniSTS 60275 UniSTS