Stk5 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Stk5

Symbol: Stk5
Also known as: Aurkb; Stk12; 
RGD ID: 5012340
Expected Size: 122 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381169,051,397 - 69,051,518UniSTSGRCm38
GRCm38666,578,311 - 66,578,417UniSTSGRCm38
MGSCv371168,864,899 - 68,865,020UniSTSGRCm37
MGSCv37666,528,305 - 66,528,411UniSTSGRCm37
Celera668,700,773 - 68,700,879UniSTS
Celera1175,994,917 - 75,995,038UniSTS
Cytogenetic Map11B3UniSTS
Cytogenetic Map6C1UniSTS
cM Map1140.0UniSTS
Is Marker For: Genes:   Aurkb   Gm5307  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAATCTGGGGCCTTCGAG
Reverse Primer TGACAAATTGAAAGGAATCAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
731310Aurkbaurora kinase B116904562469051664Mouse
2295770Gm5307predicted gene 530766657703966578563Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884453Sklq16_mskull length QTL 16, 16 week (mouse)11330000072800000Mouse
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1559002Lmrq4_mLeishmania major resistance QTL 4 (mouse)Not determined111231863769794121Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
1357782Char8_mP. chabaudi malaria resistance QTL 8 (mouse)Not determined113568778969794161Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
1301788Lbw8_mlupus NZB x NZW 8 (mouse)Not determined113661246070618665Mouse
1301896Tria1_mT-cell receptor induced activation 1 (mouse)Not determined113672273870723028Mouse
4141853Skmw17_mskeletal muscle weight 17 (mouse)Not determined113719011571190238Mouse
10766457Nwa3_mNew Zealand White autoimmunity 3 (mouse)113812528972125383Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4141875Etax9_methanol induced ataxia 9 (mouse)Not determined5539415972319101Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
10053682Eae45_mexperimental allergic encephalomyelitis susceptibility 45 (mouse)Not determined115859972974863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
11532697Sluc36_msusceptibility to lung cancer 36 (mouse)115936579169591873Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
1301999Lmr15_mleishmaniasis resistance 15 (mouse)Not determined116342858181939647Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
4142316Ity2b_mimmunity to S. typhimurium 2b (mouse)Not determined116718736579923086Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
26884441Sklq3_mskull length QTL 3, 5 week (mouse)6760000080600000Mouse
1357442Dbts1_mdiabetes 1 (mouse)Not determined61823414873387692Mouse
10412213Sxbq2_mSGC/Knj cross B6 QTL 2 (mouse)Not determined61991268671322775Mouse
13208564Bmiq7_mbody mass index QTL 7 (mouse)62500000080000000Mouse
12880425V25Dq5_mvitamin D inactive form serum level QTL 5 (mouse)63270000066700000Mouse
4141782Mrdq5_mmodifier of retinal degeneration QTL 5 (mouse)Not determined3285065078238974Mouse
1300959Lxw2_mlupus BXSB x NZW 2 (mouse)Not determined63389528167895420Mouse
11252142Mom12_mModifier of Min 12 (mouse)63389528167895420Mouse
1300767Aliq4_macute lung injury QTL 4 (mouse)Not determined63629634770296450Mouse
1357539Bsbob3_mBSB obesity 3 (mouse)Not determined63647147170471591Mouse
4141094Hrtr1_mheart rate 1 (mouse)Not determined3676447870764478Mouse
14746995Manh60_mmandible shape 60 (mouse)63722567771225677Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1301326Trbv4c2_mT cell receptor beta variable 4 (mouse)Not determined64089129671379171Mouse
12880424V25Dq4_mvitamin D inactive form serum level QTL 4 (mouse)64160000075600000Mouse
1301266Lmr4_mleishmaniasis resistance 4 (mouse)Not determined64211637376116515Mouse
11040600Lmr4c_mleishmaniasis resistance 4c (mouse)64211637376116515Mouse
11040601Lmr4a_mleishmaniasis resistance 4a (mouse)64211637376116515Mouse
11533915Mts4_mmammary tumor susceptibility 4 (mouse)64211637376116515Mouse
12910785Pwgrq16_mpost-weaning growth rate QTL 16 (mouse)64382681377811523Mouse
12910798Pwgrq5_mpre-weaning growth rate QTL 5 (mouse)64382681377811523Mouse
12910802Pwbwq12_mpost-weaning body weight QTL 12 (mouse)64382681377811523Mouse
12910807Pwbwq11_mpost-weaning body weight QTL 11 (mouse)64382681377811523Mouse
12910809Pwbwq10_mpost-weaning body weight QTL 10 (mouse)64382681377811523Mouse
12910820Ogrq3_moverall growth rate QTL 3 (mouse)64382681377811523Mouse
10043885Cia6c_mcollagen induced arthritis QTL 6c (mouse)Not determined64446587171119467Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
4140983Srilp_msleep response to influenza, light phase (mouse)Not determined4872655675447710Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1204812 UniSTS
NCBI Gene 20877 UniSTS
  384398 UniSTS
UniSTS 144520 UniSTS