Igk-C Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Igk-C

Symbol: Igk-C
Also known as: Igkc; 
RGD ID: 5010800
Expected Size: 179 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38670,726,637 - 70,726,815UniSTSGRCm38
MGSCv37670,676,631 - 70,676,809UniSTSGRCm37
Celera672,812,071 - 72,812,249UniSTS
Cytogenetic Map6C1UniSTS
Cytogenetic Map6CUniSTS
cM Map630.0UniSTS
Is Marker For: Genes:   Igk  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGCAGCACCCTCACGTT
Reverse Primer AGAAGGGAAGATAGGATGGAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1621288Igkimmunoglobulin kappa chain complex66755563670726754Mouse
10783Igkcimmunoglobulin kappa constant67072643570726754Mouse

Nucleotide Sequences
GenBank Nucleotide AB097848 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB097850 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB453397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB538878 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC153612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC156398 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF466768 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF466770 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ487682 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ555479 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AM745100 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY571286 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY571288 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC002035 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC002112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC006643 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC013496 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC015292 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC019474 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC019760 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC021781 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC027418 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC028540 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC028925 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC031349 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC031498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC055906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC055911 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC080787 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC082779 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC084683 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC091738 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC091750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC091754 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092080 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092090 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092097 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC092251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC094013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC094049 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC106159 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC106161 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC108385 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC110685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D14630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FN422002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL592262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L00089 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L27438 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L80040 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M63550 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S65921 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U65535 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V00777 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V00802 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V00807 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V00810 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V01569 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X02816 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X13187 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X56394 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X67211 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X70424 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X79906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X87231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
26884441Sklq3_mskull length QTL 3, 5 week (mouse)6760000080600000Mouse
1357442Dbts1_mdiabetes 1 (mouse)Not determined61823414873387692Mouse
10412213Sxbq2_mSGC/Knj cross B6 QTL 2 (mouse)Not determined61991268671322775Mouse
13208564Bmiq7_mbody mass index QTL 7 (mouse)62500000080000000Mouse
4141782Mrdq5_mmodifier of retinal degeneration QTL 5 (mouse)Not determined3285065078238974Mouse
4141094Hrtr1_mheart rate 1 (mouse)Not determined3676447870764478Mouse
14746995Manh60_mmandible shape 60 (mouse)63722567771225677Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1301326Trbv4c2_mT cell receptor beta variable 4 (mouse)Not determined64089129671379171Mouse
12880424V25Dq4_mvitamin D inactive form serum level QTL 4 (mouse)64160000075600000Mouse
1301266Lmr4_mleishmaniasis resistance 4 (mouse)Not determined64211637376116515Mouse
11040600Lmr4c_mleishmaniasis resistance 4c (mouse)64211637376116515Mouse
11040601Lmr4a_mleishmaniasis resistance 4a (mouse)64211637376116515Mouse
11533915Mts4_mmammary tumor susceptibility 4 (mouse)64211637376116515Mouse
12910785Pwgrq16_mpost-weaning growth rate QTL 16 (mouse)64382681377811523Mouse
12910798Pwgrq5_mpre-weaning growth rate QTL 5 (mouse)64382681377811523Mouse
12910802Pwbwq12_mpost-weaning body weight QTL 12 (mouse)64382681377811523Mouse
12910807Pwbwq11_mpost-weaning body weight QTL 11 (mouse)64382681377811523Mouse
12910809Pwbwq10_mpost-weaning body weight QTL 10 (mouse)64382681377811523Mouse
12910820Ogrq3_moverall growth rate QTL 3 (mouse)64382681377811523Mouse
10043885Cia6c_mcollagen induced arthritis QTL 6c (mouse)Not determined64446587171119467Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
4140983Srilp_msleep response to influenza, light phase (mouse)Not determined4872655675447710Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1204803 UniSTS
NCBI Gene 110759 UniSTS
  16071 UniSTS
  16098 UniSTS
  16114 UniSTS
  243469 UniSTS
  384419 UniSTS
  546213 UniSTS
  626347 UniSTS
  637227 UniSTS
  640340 UniSTS
  667683 UniSTS
UniSTS 143506 UniSTS