Gcdh Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Gcdh

Symbol: Gcdh
Also known as:
RGD ID: 5010317
Expected Size: 166 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38884,886,619 - 84,886,781UniSTSGRCm38
MGSCv37887,410,518 - 87,410,680UniSTSGRCm37
Celera889,186,176 - 89,186,341UniSTS
Cytogenetic Map8C3UniSTS
cM Map838.6UniSTS
Is Marker For: Genes:   Gcdh   Syce2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCCTCCACCTACCCTGTTT
Reverse Primer CTGTTCAGTGCACATAGAAGGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1204998 UniSTS
NCBI Gene 270076 UniSTS
  71846 UniSTS
UniGene Mm.2475 UniSTS
UniSTS 143184 UniSTS