D9Mgc42e Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D9Mgc42e

Symbol: D9Mgc42e
Also known as:
RGD ID: 5009660
Expected Size: 94 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389102,418,989 - 102,419,068UniSTSGRCm38
GRCm385115,284,925 - 115,285,003UniSTSGRCm38
MGSCv375115,734,934 - 115,735,012UniSTSGRCm37
MGSCv379102,321,319 - 102,321,398UniSTSGRCm37
Celera9101,966,442 - 101,966,521UniSTS
Celera5112,382,621 - 112,382,699UniSTS
Cytogenetic Map5FUniSTS
cM Map956.0UniSTS
Is Marker For: Genes:   Coq5  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTTTGAGTCCCAGCATGACA
Reverse Primer GACTCAGAAGAGGGCATCAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1322001Coq5coenzyme Q5 methyltransferase5115279666115296974Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
11341716Rvfs3_mRift Valley fever susceptibility 3 (mouse)526236236138457140Mouse
4142064Tmc1m4_mTmc1 modifier 4 (mouse)Not determined554342835126924008Mouse
26884395Humsd2_mhumerus midshaft diameter 2, 10 week (mouse)569900000132500000Mouse
27226719Tibw6_mtibia width 6, proximal, 16 week (mouse)572700000140000000Mouse
13506928Recrq8_mrecombination rate in male meiosis QTL 8 (mouse)574300000132500000Mouse
25314315Mlh1fc4_mMLH1 foci count 4 (mouse)574300000132500000Mouse
1357431Cia27_mcollagen induced arthritis 27 (mouse)Not determined575154687119880564Mouse
10401245Bglu18_mblood glucose level 18 (mouse)Not determined582690609116690738Mouse
13464242Ahl17_mage related hearing loss, early onset 17 (mouse)582690609116690738Mouse
1300801Drb2_mdopamine receptor binding 2 (mouse)Not determined587239005121239199Mouse
1301399Cpfd3_mcerebellum pattern fissures (mouse)Not determined587239005121239199Mouse
1301126Bwem1_mbody weight day 30 males 1 (mouse)Not determined587239005121239199Mouse
10043958Chldq12_mcholesterol and HDL QTL 12 (mouse)Not determined587239005121239199Mouse
13464241Ahl18_mage related hearing loss, early onset 18 (mouse)587239005121239199Mouse
1357725Eae39_mexperimental allergic encephalomyelitis 39 (mouse)Not determined589271017118725963Mouse
1300968Skts4_mskin tumor susceptibility 4 (mouse)Not determined589271017124100176Mouse
1301362Prnr1_mprion resistance 1 (mouse)Not determined589271017146851125Mouse
11049562Lmr24f_mleishmaniasis resistance 24f (mouse)590173096124173175Mouse
1301457Cfsw2_mcystic fibrosis survival to weaning 2 (mouse)Not determined590413140124413285Mouse
1300993Hycdc_mhypercapnic duty cycle (mouse)Not determined590413140124413285Mouse
9587780Afw16_mabdominal fat weight QTL 16 (mouse)Not determined592682300126682419Mouse
1301974Chab7_mcholesterol absorption 7 (mouse)Not determined595085348129085464Mouse
1357644Egrd1_mearly growth rate, direct effect 1 (mouse)Not determined595286714129286920Mouse
1558774Lith17_mlithogenic gene 17 (mouse)Not determined595317683129317856Mouse
10402486Dipa1_mdrug induced psychomotor activation 1 (mouse)Not determined595317683129317856Mouse
13464244Ahl19_mage related hearing loss, early onset 19 (mouse)595317683129317856Mouse
1300940Actd3_mactivity-distance traveled 3 (mouse)Not determined596172519130172667Mouse
1300659Pcd8ts1_mp-glycoprotein positive CD8 T cell subset 1 (mouse)Not determined596883692130883925Mouse
1301858Smdq1_msegregation of mitochondrial DNA QTL 1 (mouse)Not determined596883692130883925Mouse
1301042Elmaz1_melevated maze behavior 1 (mouse)Not determined597871790116738565Mouse
4141519Hmtb5_mhemostasis and thrombosis bleeding time 5 (mouse)Not determined99801563126805880Mouse
12904945Tammq2_mtibialis anterior muscle mass QTL 2 (mouse)5100527900134527900Mouse
12904959Smmq1_msoleus muscle mass QTL 1 (mouse)5100527900134527900Mouse
12859290Criq2_mCitrobacter rodentium infection QTL 2 (mouse)5101194514135194514Mouse
1301624Aevm2_mautoimmune extremity vasculitis in MRL mice 2 (mouse)Not determined5101725767135725963Mouse
14746986Manh58_mmandible shape 58 (mouse)5102308218136308218Mouse
11532736Sluc33b_msusceptibility to lung cancer 33b (mouse)5102806972136807131Mouse
25314310Syncl4_msynaptonemal complex length 4 (mouse)5102900000115400000Mouse
11528550Sluc33_msusceptibility to lung cancer 33 (mouse)5104239005120573921Mouse
10412202Bbaa26_mB.burgdorferi-associated arthritis 26 (mouse)Not determined5104435822138557193Mouse
10412239Alpq7_malcohol preference QTL 7 (mouse)Not determined5104567876138567876Mouse
4142473Chlq11_mcirculating hormone level QTL 11 (mouse)Not determined5107829235141829348Mouse
10043890Trigq4_mtriglyceride QTL 4 (mouse)Not determined5107829235141829348Mouse
13464243Ahl20_mage related hearing loss, early onset 20 (mouse)5107829235141829348Mouse
4141139Hmtb4_mhemostasis and thrombosis rebleeding time 4 (mouse)Not determined108614643126805880Mouse
10412197Bbaa25_mB.burgdorferi-associated arthritis 25 (mouse)Not determined5109090176143090317Mouse
13464251Ahl21_mage related hearing loss, early onset 21 (mouse)5109090176143090317Mouse
1301543Hypch_mhypercholesterolemia (mouse)Not determined5109090758139133150Mouse
1300913Bwefm_mbody weight females and males day 10 (mouse)Not determined5109362284143362395Mouse
4141652Mrdq2_mmodifier of retinal degeneration QTL 2 (mouse)Not determined110105240117955608Mouse
1301102Cia14_mcollagen induced arthritis 14 (mouse)Not determined5113172519138557193Mouse
1357662Lprq4_mlipoprotein QTL 4 (mouse)Not determined5113883692129555542Mouse
1300827Cora1_mcorrelation in cytokine production 1 (mouse)Not determined5115128044149128176Mouse
1301226Bbaa2_mB.burgdorferi-associated arthritis 2 (mouse)Not determined5115128044149128176Mouse
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1357610Vtbt8_mvertebral trabecular bone trait 8 (mouse)Not determined968897510102897652Mouse
1301924Bmd10_mbone mineral density 10 (mouse)Not determined968897510102897652Mouse
1301302Pas4_mpulmonary adenoma susceptibility 4 (mouse)Not determined969239845103239920Mouse
1301621Hpic1_mhaloperidol-induced catalepsy 1 (mouse)Not determined969546513103546645Mouse
1301573Etohcta8_methanol conditioned taste aversion 8 (mouse)Not determined972977005106977152Mouse
10054068El8_mepilepsy 8 (mouse)Not determined972977005106977152Mouse
1301725Lifespan1_mlife span 1 (mouse)Not determined974368177108368325Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1331050 UniSTS
NCBI Gene 28132 UniSTS
  28133 UniSTS
  52064 UniSTS
UniSTS 142784 UniSTS