D6Wsu120e Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D6Wsu120e

Symbol: D6Wsu120e
Also known as: Suclg2; 
RGD ID: 5009382
Expected Size: 250 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38695,474,239 - 95,474,488UniSTSGRCm38
GRCm38X157,015,421 - 157,015,670UniSTSGRCm38
MGSCv37X153,449,964 - 153,450,213UniSTSGRCm37
MGSCv37695,424,233 - 95,424,482UniSTSGRCm37
CeleraX140,275,577 - 140,275,826UniSTS
Celera697,363,909 - 97,364,158UniSTS
Cytogenetic Map6D3UniSTS
Cytogenetic MapXF4UniSTS
cM Map641.0UniSTS
Is Marker For: Genes:   Suclg2   Gm15163  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAAAAGGACATCATTAGGAA
Reverse Primer GAATCTACTGTTTGCCTCAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1312780Suclg2succinate-Coenzyme A ligase, GDP-forming, beta subunit69547300995718858Mouse
2295689Gm15163predicted gene 15163X157015331157017562Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
11532719Sluc45_msusceptibility to lung cancer 45 (mouse)69260730698258933Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1357823Spha3_msperm head anomaly 3 (mouse)Not determinedX103012242163975945Mouse
1301209Cia19_mcollagen induced arthritis 19 (mouse)Not determinedX122083468161430042Mouse
10412164Cmv2_mcytomegalovirus resistance 2 (mouse)Not determinedX126902153160902273Mouse
1558900Bw3_mbody weight QTL 3 (mouse)Not determinedX134639291166515599Mouse
1302000Pgia25_mproteoglycan induced arthritis 2 (mouse)Not determinedX145691384171031299Mouse
10401118Pgia39_mproteoglycan induced arthritis 39 (mouse)Not determinedX145691384171031299Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1331902 UniSTS
NCBI Gene 20917 UniSTS
  434885 UniSTS
UniSTS 142647 UniSTS