D15Mit274 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15Mit274

Symbol: D15Mit274
Also known as:
RGD ID: 5008134
Expected Size: 107 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381543,783,428 - 43,783,534UniSTSGRCm38
MGSCv371543,614,974 - 43,615,080UniSTSGRCm37
Celera1544,245,903 - 44,246,011UniSTS
cM Map15 UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTAGGTATCAAGGTAGAAAATCAAAGG
Reverse Primer ATATGTGTTTTTAATGATATGAGTGCG
 

Region

Nucleotide Sequences
GenBank Nucleotide AC099629 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL592112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10401902Sicd2_mseizure-induced cell death 2 (mouse)Not determined15344490771325689Mouse
4141952W3q7_mweight 3 weeks QTL 7 (mouse)Not determined346021278717086Mouse
4142448Tailq6_mtail length QTL 6 (mouse)Not determined346021278717086Mouse
4142252Tailaq4_mtail length adjusted QTL 4 (mouse)Not determined346021278717086Mouse
1357559Scfq2_msubcutaneous fat pad weight QTL 2 (mouse)Not determined15346021278717086Mouse
1357659Epfpq4_mepididymal fat percentage QTL 4 (mouse)Not determined15346021278717086Mouse
26884384Skwq12_mskull length QTL 12, 16 week (mouse)15610000050900000Mouse
26884387Skwq8_mskull length QTL 8, 10 week (mouse)15610000068400000Mouse
26884412Bzwq10_mbi-zygomatic width QTL 10, 10 week (mouse)15610000071600000Mouse
26884417Bzwq4_mbi-zygomatic width QTL 4, 5 week (mouse)15610000072600000Mouse
27226786Feml11_mfemur length 11, 5 week (mouse)15610000076000000Mouse
27095932Ulnl11_mulna length 11, 16 week (mouse)15610000076500000Mouse
27226717Tibw4_mtibia width 4, proximal, 10 week (mouse)15610000078800000Mouse
27226734Tibmd5_mtibia midshaft diameter 5, 10 week (mouse)15610000086800000Mouse
26884442Sklq6_mskull length QTL 6, 5 week (mouse)156100000100900000Mouse
26884429Zlq6_mzygomatic length QTL 6, 10 week (mouse)15680000045100000Mouse
27226721Tibw8_mtibia width 8, proximal, 16 week (mouse)15690000076000000Mouse
27226773Tibl16_mtibia length 16, 10 week (mouse)15690000076000000Mouse
27226777Tibl8_mtibia length 8, 5 week (mouse)15690000084700000Mouse
27095940Ulnl8_mulna length 8, 10 week (mouse)15720000055400000Mouse
27226759Feml17_mfemur length 17, 10 week (mouse)15760000055400000Mouse
27226755Feml22_mfemur length 22, 16 week (mouse)15760000059400000Mouse
26884439Sklq11_mskull length QTL 11, 10 week (mouse)15810000047800000Mouse
4141192Ssrq2_mstress response QTL 2 (mouse)Not determined927293656323454Mouse
1301433Rapop5_mradiation-induced apoptosis 5 (mouse)Not determined15927293679590561Mouse
1357526Hyplip2_mhyperlipidemia 2 (mouse)Not determined1512402117102988123Mouse
1302165Yv_myellow value (mouse)Not determined151384686047847002Mouse
1301020Pheo_mpheomelanin (mouse)Not determined151384686047847002Mouse
1301951Eila3_methanol induced locomotor activity 3 (mouse)Not determined151492744148927610Mouse
4141423Nstr2_mnerve sheath tumor resistance QTL 2 (mouse)Not determined1492744148927610Mouse
1302007Bbaa14_mB.burgdorferi-associated arthritis 14 (mouse)Not determined151492744148927610Mouse
1301499Bdln2_mbody length 2 (mouse)Not determined151564519749645324Mouse
12859288Criq1_mCitrobacter rodentium infection QTL 1 (mouse)151603380850033808Mouse
26884423Zlq10_mzygomatic length QTL 10, 16 week (mouse)152060000050900000Mouse
14928313Manh78_mmandible shape 78 (mouse)152148439755484397Mouse
12859289Criq3_mCitrobacter rodentium infection QTL 3 (mouse)152273036956730369Mouse
4142160Femwf10_mfemur work to failure 10 (mouse)Not determined2302961857029764Mouse
1301557Bbaa22_mB.burgdorferi-associated arthritis 22 (mouse)Not determined152459917658599409Mouse
1300967Bdt6_mbone density traits 6 (mouse)Not determined152543241059432532Mouse
4141409Radsvq1_mradiation sensitivity QTL 1 (mouse)Not determined2562158259621582Mouse
1301345Bgeq14_mbody growth early QTL 14 (mouse)Not determined152644838460448484Mouse
1300772Bglq16_mbody growth late QTL 16 (mouse)Not determined152644838460448484Mouse
1357514Mbis3_mMycobacterium bovis-induced systemic lupus erythematosus 3 (mouse)Not determined162644838460448484Mouse
1301406Egrd2_mearly growth rate (mouse)Not determined152644838460448484Mouse
27226800Scvln20_msacral vertebrae length 2, 16 week (mouse)152660000066500000Mouse
1301450Bpq6_mblood pressure QTL 6 (mouse)Not determined152841925062419343Mouse
1357512Bsbob5_mBSB obesity 5 (mouse)Not determined152841925062419343Mouse
26884425Cvht2_mcranial vault height 2, 5 week (mouse)1528800000102100000Mouse
26884392Humsd8_mhumerus midshaft diameter 8, 16 week (mouse)152930000076200000Mouse
26884452Sklq17_mskull length QTL 17, 16 week (mouse)153020000058100000Mouse
1558985Eae32_mexperimental allergic encephalomyelitis susceptibility 32 (mouse)Not determined1532578270103517472Mouse
1300578Cd8ts3_mCD8 T cell subset 3 (mouse)Not determined153414129868141408Mouse
1301324Cdif_mcolor difference (mouse)Not determined153611251070112623Mouse
27226729Tibmd2_mtibia midshaft diameter 2, 5 week (mouse)153800000086800000Mouse
1301580Hrq2_mheart rate quantitative locus 2 (mouse)Not determined153923699973237197Mouse
1300949Lore5_mloss of righting induced by ethanol 5 (mouse)Not determined154015604558158901Mouse
4142459Lfnq3_mlung function QTL 3 (mouse)Not determined4031362672500731Mouse
10412206Bbaa31_mB.burgdorferi-associated arthritis 31 (mouse)Not determined154159917643794128Mouse
26884402Cvht9_mcranial vault height 9, 16 week (mouse)154230000095600000Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1347881 UniSTS
UniSTS 142018 UniSTS