Cmkbr5 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Cmkbr5

Symbol: Cmkbr5
Also known as: Ccr5; 
RGD ID: 5006856
Expected Size: 157 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389124,125,239 - 124,125,395UniSTSGRCm38
MGSCv379124,039,978 - 124,040,134UniSTSGRCm37
Celera9124,874,321 - 124,874,477UniSTS
Cytogenetic Map9FUniSTS
cM Map972.0UniSTS
Is Marker For: Genes:   Ccr5  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCTAAACCCTGTCATCTATGC
Reverse Primer GTGGATCGGGTATAGACTGAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
733487Ccr5chemokine (C-C motif) receptor 59124121543124127183Mouse

Nucleotide Sequences
RefSeq Transcripts NM_009917 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC168021 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF019772 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF022990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY399290 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC103574 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC103586 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC103587 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC105643 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH466671 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR139136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D83648 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL456153 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL592630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH801627 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KB727602 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U47036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U68565 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U83327 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X94151 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1205232 UniSTS
NCBI Gene 12774 UniSTS
UniSTS 141359 UniSTS