CRK Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: CRK

Symbol: CRK
Also known as:
RGD ID: 5004815
Expected Size: 319 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381175,692,241 - 75,692,559UniSTSGRCm38
MGSCv371175,505,743 - 75,506,061UniSTSGRCm37
Celera1183,201,350 - 83,201,668UniSTS
Cytogenetic Map11A-DUniSTS
Is Marker For: Genes:   Crk  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCATTGCCTGCTTTACTGGA
Reverse Primer CAATCAGAGCCGATACTGAGG
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 12928 UniSTS
UniSTS 266693 UniSTS