PCBP1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: PCBP1

Symbol: PCBP1
Also known as:
RGD ID: 5004797
Expected Size: 123 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38687,512,845 - 87,512,966UniSTSGRCm38
GRCm38686,524,562 - 86,524,684UniSTSGRCm38
MGSCv37687,462,839 - 87,462,960UniSTSGRCm37
MGSCv37686,474,556 - 86,474,678UniSTSGRCm37
Celera688,462,524 - 88,462,646UniSTS
Celera689,448,029 - 89,448,150UniSTS
Cytogenetic Map6D1UniSTS
Is Marker For: Genes:   Pcbp1   Arhgap25   1600020E01Rik  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CATTCCACTCTTACATTTCTTATCG
Reverse Primer GCTGTTAATGCTGGGATCCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1557062Pcbp1poly(rC) binding protein 168652448086526189Mouse
16199891600020E01RikRIKEN cDNA 1600020E01 gene68652733086564449Mouse
10026391Gm38676predicted gene, 3867668652876486531209Mouse
12795490Gm46963predicted gene, 4696368660442186627858Mouse
9608427Gm33740predicted gene, 3374068660476286627858Mouse
1558009Asprv1aspartic peptidase, retroviral-like 168662817486629710Mouse
1557837Mxd1MAX dimerization protein 168664704486669234Mouse
10029014Gm38850predicted gene, 3885068665395486663064Mouse
1322108Snrnp27small nuclear ribonucleoprotein 27 (U4/U6.U5)68667516986684491Mouse
1552095Gmcl1germ cell-less, spermatogenesis associated 168669176886733395Mouse
735939Anxa4annexin A468673684086793634Mouse
16098522610306M01RikRIKEN cDNA 2610306M01 gene68684840786849440Mouse
1618841Aak1AP2 associated kinase 168684927487003227Mouse
1317242Nfu1NFU1 iron-sulfur cluster scaffold68700923487028461Mouse
1557517Gfpt1glutamine fructose-6-phosphate transaminase 168704284687092207Mouse
15021135Gm52909predicted gene, 5290968709358687094223Mouse
1621564D6Ertd527eDNA segment, Chr 6, ERATO Doi 527, expressed68709712587113003Mouse
10010284Gm40382predicted gene, 4038268712704587132739Mouse
1316163Antxr1anthrax toxin receptor 168713385387335809Mouse
10023024Gm38851predicted gene, 3885168722313187267447Mouse
9665906Gm34170predicted gene, 3417068728276587285453Mouse
9660223Gm34090predicted gene, 3409068732306787332036Mouse
1549983Gkn1gastrokine 168734565387350915Mouse
1332561Gkn2gastrokine 268737336587379494Mouse
1316989Gkn3gastrokine 368738331987388935Mouse
1558624Bmp10bone morphogenetic protein 1068742899487434512Mouse
1617350Arhgap25Rho GTPase activating protein 2568745854487533261Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 232201 UniSTS
  23983 UniSTS
  72012 UniSTS
UniSTS 266025 UniSTS