Npy1r Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Npy1r

Symbol: Npy1r
Also known as:
RGD ID: 5004586
Expected Size: 61 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38866,704,005 - 66,704,065UniSTSGRCm38
Celera869,258,143 - 69,258,203UniSTS
Cytogenetic Map8B3-C2UniSTS
Is Marker For: Genes:   Npy1r  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTTTTGAAAATGATGACTGCCA
Reverse Primer AAGCGAGAGCCAAGGTGAATA
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4835527 UniSTS
NCBI Gene 18166 UniSTS
UniGene Mm.5112 UniSTS
UniSTS 531347 UniSTS