Npy1r Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Npy1r

Symbol: Npy1r
Also known as: UniSTS:256984; 
RGD ID: 5004485
Expected Size: 368 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38866,704,734 - 66,705,101UniSTSGRCm38
MGSCv37869,228,633 - 69,229,000UniSTSGRCm37
Celera869,258,872 - 69,259,239UniSTS
Cytogenetic Map8B3-C2UniSTS
Is Marker For: Genes:   Npy1r  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGATATACATTCGCTTGAAAAGGAG
Reverse Primer CATGGTAGACATGGCTATGGTCTCG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:2659022 UniSTS
NCBI Gene 18166 UniSTS
UniGene Mm.5112 UniSTS
UniSTS 256984 UniSTS