MARC_7076-7077:992008234:1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: MARC_7076-7077:992008234:1

Symbol: MARC_7076-7077:992008234:1
Also known as:
RGD ID: 5004354
Expected Size: 252 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38716,916,819 - 16,917,168UniSTSGRCm38
GRCm38696,032,870 - 96,033,121UniSTSGRCm38
MGSCv37695,982,864 - 95,983,115UniSTSGRCm37
MGSCv37717,502,168 - 17,502,517UniSTSGRCm37
Celera714,123,249 - 14,123,598UniSTS
Celera697,911,220 - 97,911,471UniSTS
Cytogenetic Map6D3UniSTS
Cytogenetic Map7A2UniSTS
cM Map74.0UniSTS
Is Marker For: Genes:   Calm3   Gm5881  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGACGAACCTGGGCGAG
Reverse Primer TTTTGTTGCTTTATCAGATTCTCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
16126852900060L22RikRIKEN cDNA 2900060L22 gene69602263496121422Mouse
2306730Gm5881predicted gene 588169603299796033370Mouse
10282Calm3calmodulin 371691537916924032Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
11532719Sluc45_msusceptibility to lung cancer 45 (mouse)69260730698258933Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1301377Mprf_mmaternal performance (mouse)Not determined7120266693Mouse
10043984Pbft4_mpercent body fat 4 (mouse)Not determined7120266693Mouse
1301177Vent3_mventricular size 3 (mouse)Not determined7120463409Mouse
10054067Sle20_msystematic lupus erythematosus susceptibility 20 (mouse)Not determined7120463409Mouse
1302188Lxw6_mlupus BXSB x NZW 6 (mouse)Not determined7121695147Mouse
12904941Edlmmq6_mextensor digitorum longus muscle mass QTL 6 (mouse)7121818048Mouse
12904948Tammq5_mtibialis anterior muscle mass QTL 5 (mouse)7121818048Mouse
12904953Gmmq5_mgastrocnemius muscle mass QTL 5 (mouse)7121818048Mouse
1301572Sluc30_msusceptibility to lung cancer 30 (mouse)Not determined7269777136697919Mouse
1301115Lrdm1_mlymphoproliferation (Fas) renal disease modifier 1 (mouse)Not determined7330353225179993Mouse
1300722Sle3_msystemic lupus erythmatosus susceptibility 3 (mouse)Not determined7346321287493512Mouse
38501068Tip1_mtuberculosis immunophenotype 1, spleen CFU (mouse)7360000072900000Mouse
25394569Skmw57_mskeletal muscle weight 57, gastroc (mouse)7457747016953936Mouse
25314307Mlh1fc2_mMLH1 foci count 2 (mouse)76500000133900000Mouse
1357699Nhdlq6_mnon-HDL QTL 6 (mouse)Not determined71028944244289559Mouse
1558893Spir1_mStreptococcus pneumoniae infection resistance 1 (mouse)Not determined71060637344606511Mouse
10449139Eosn1_meosinophil differential 1 (mouse)71278145246781452Mouse
10449158Eosn3_meosinophil differential 3 (mouse)71278145246781452Mouse
4141566Femwf8_mfemur work to failure 8 (mouse)Not determined1333306047333196Mouse
11522751Cocia17_mcocaine-induced activity, QTL 17 (mouse)71343577947435779Mouse
25314314Sccor1_msynaptonemal complex length to mean MLH1 count ratio 1 (mouse)71360000047700000Mouse
1559016Drsi_mDCC-related Spp1 induction (mouse)Not determined71690336849509583Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 12315 UniSTS
  545867 UniSTS
UniSTS 231299 UniSTS