D8Mit9 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mit9

Symbol: D8Mit9
Also known as: A62; 
RGD ID: 5002274
Expected Size: 150 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38871,706,614 - 71,706,763UniSTSGRCm38
MGSCv37874,230,513 - 74,230,662UniSTSGRCm37
Celera874,221,040 - 74,221,189UniSTS
Celera1868,727,326 - 68,728,208UniSTS
Cytogenetic Map18E1UniSTS
cM Map833.5UniSTS
Whitehead Genetic835.0UniSTS
Whitehead_YAC8 UniSTS
Is Marker For: Genes:   Afg3l2   Gm18860  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATTTGAATTGTGCAGACCTGG
Reverse Primer CTGCTTGTTTTTATCTCCTGGG
 

Region



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:707579 UniSTS
NCBI Gene 100417840 UniSTS
  492980 UniSTS
  69597 UniSTS
UniSTS 131636 UniSTS