U42386 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: U42386

Symbol:

U42386

Also known as:

RGD ID:

5001787

Expected Size:

151 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	6	102,937,032 - 102,937,182	UniSTS	GRCm38
GRCm38	X	13,293,045 - 13,293,195	UniSTS	GRCm38
MGSCv37	6	102,887,026 - 102,887,176	UniSTS	GRCm37
MGSCv37	X	12,870,171 - 12,870,321	UniSTS	GRCm37
Celera	6	104,807,308 - 104,807,458	UniSTS
Celera	X	10,967,334 - 10,967,484	UniSTS
Cytogenetic Map	X	A1.1	UniSTS
Whitehead_YAC	X		UniSTS

Is Marker For:

Genes: Ddx3x

Annotation

References - curated


1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CCCTTGTACATTTGGCCCAT
Reverse Primer	CCTTTCCTAGACAAGCTGCG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1557808	Ddx3x	DEAD box helicase 3, X-linked	X	13280496	13293988	Mouse

Nucleotide Sequences


RefSeq Transcripts	NM_010028	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC153992	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC159548	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL833805	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC067210	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC083059	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DQ858457	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DQ858458	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DQ858459	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FR012021	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	U42386	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
25440480	Moaq2_m	modifier of alien QTL 2 (mouse)					6	1	117500000	Mouse
26884414	Bzwq12_m	bi-zygomatic width QTL 12, 16 week (mouse)					6	3400000	139100000	Mouse
10412157	Fl1n_m	fatty liver 1 in NSY (mouse)			Not determined		6	45314059	128835032	Mouse
4142259	Tabw2_m	tally ho associated body weight 2 (mouse)			Not determined			46935985	136423692	Mouse
25314319	Histh6_m	histamine hypersensitivity 6 (mouse)					6	48720000	125360000	Mouse
25314320	Histh5_m	histamine hypersensitivity 5 (mouse)					6	48720000	148450000	Mouse
1301962	Eila2_m	ethanol induced locomotor activity 2 (mouse)			Not determined		6	48726556	125356785	Mouse
1357683	Igf1sl1_m	IGF-1 serum levels 1 (mouse)			Not determined		6	52161713	116155267	Mouse
1301876	Bits2_m	bitterness sensitivity 2 (mouse)			Not determined		6	70425898	104426034	Mouse
1301813	Skl3_m	skeletal size (tail length) 3 (mouse)			Not determined		6	70425898	104426034	Mouse
1301034	Egrm2_m	early growth rate (mouse)			Not determined		6	70425898	104426034	Mouse
1300869	Stheal5_m	soft tissue heal 5 (mouse)			Not determined		6	71575060	105575178	Mouse
1300954	Fcsa1_m	femoral cross-sectional area 1 (mouse)			Not determined		6	71981024	105981170	Mouse
1301521	Pas1c_m	pulmonary adenoma susceptibility 1c (mouse)			Not determined		6	71981024	105981170	Mouse
13506930	Recrq9_m	recombination rate in male meiosis QTL 9 (mouse)					6	73500000	134700000	Mouse
1301320	Ots1_m	ovarian teratoma susceptibility 1 (mouse)			Not determined		6	75447583	104503555	Mouse
10043901	Pfat5_m	predicted fat percentage 5 (mouse)			Not determined		6	75607306	109607450	Mouse
10412208	Cypr4_m	cytokine production 4 (mouse)			Not determined		6	75716503	109716697	Mouse
1357875	Pfat2_m	predicted fat percentage 2 (mouse)			Not determined		6	76463949	110464093	Mouse
4141376	Dbm1_m	diabetes modifier 1 (mouse)			Not determined		6	78629504	121115387	Mouse
10043864	T2dm4sa_m	type 2 diabetes mellitus 4 in SMXA RI mice (mouse)			Not determined		6	83713869	147052561	Mouse
11251720	Ewc4_m	ethanol withdrawal and consumption 4 (mouse)					6	84122513	118122513	Mouse
1301687	Mnic2_m	macronutrient intake (mouse)			Not determined		6	86806805	113544602	Mouse
1301744	Hdlq11_m	HDL QTL 11 (mouse)			Not determined		6	87503360	121503555	Mouse
1301262	Gasa3_m	gastritis type A susceptibility locus 3 (mouse)			Not determined		6	89005405	123005603	Mouse
1301244	Ichs_m	immediate cutaneous hypersensitivity QTL (mouse)			Not determined		6	90795610	124795846	Mouse
4141578	Obrq1_m	obesity resistance QTL 1 (mouse)			Not determined			92607306	112004738	Mouse
11353842	Bmiq4_m	body mass index QTL 4 (mouse)					6	92607306	146429238	Mouse
1301292	Cfbw2_m	cystic fibrosis body weight 2 (mouse)			Not determined		6	95004651	129004738	Mouse
1300704	Cia3_m	collagen induced arthritis QTL 3 (mouse)			Not determined		6	96347325	130347522	Mouse
11040599	Lmr4b_m	leishmaniasis resistance 4b (mouse)					6	96347325	130347522	Mouse
4141940	W6q5_m	weight 6 weeks QTL 5 (mouse)			Not determined			96655951	146633626	Mouse
4142416	Egq11_m	early growth QTL 11 (mouse)			Not determined			96655951	146633626	Mouse
1357555	Tesq2_m	testis weight QTL 2 (mouse)			Not determined		6	96655951	146633626	Mouse
10043923	Bhr7_m	bronchial hyperresponsiveness 7 (mouse)			Not determined		6	98242853	132242977	Mouse
1301518	Bbaa5_m	B.burgdorferi-associated arthritis 5 (mouse)			Not determined		6	98506837	145935444	Mouse
1301923	Lith6_m	lithogenic gene 6 (mouse)			Not determined		6	98717516	132717715	Mouse
1301915	Chab3_m	cholesterol absorption 3 (mouse)			Not determined		6	98931748	132940036	Mouse
1302131	Bmd8_m	bone mineral density 8 (mouse)			Not determined		6	99155128	133155267	Mouse
1302195	Pbwg10_m	postnatal body weight growth 10 (mouse)			Not determined		X	1	26335934	Mouse
1357433	Dbts2_m	diabetes 2 (mouse)			Not determined		X	7360056	151324042	Mouse
1301551	Spha1_m	sperm head anomaly 1 (mouse)			Not determined		X	10399986	40832775	Mouse
13208553	Wght11_m	weight 11 (mouse)					X	12000000	60000000	Mouse
13208557	Lgth13_m	body length 13 (mouse)					X	12000000	60000000	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	13205	UniSTS
UniSTS	125746	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description: