GDB:197863 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: GDB:197863

Symbol: GDB:197863
Also known as:
RGD ID: 5001513
Expected Size: 150 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381172,834,421 - 72,834,570UniSTSGRCm38
GRCm38935,213,957 - 35,214,237UniSTSGRCm38
MGSCv37935,021,542 - 35,021,822UniSTSGRCm37
MGSCv371172,647,923 - 72,648,072UniSTSGRCm37
Celera1180,363,256 - 80,363,405UniSTS
Celera932,450,680 - 32,450,960UniSTS
Cytogenetic Map9A5.3UniSTS
Cytogenetic Map11B4UniSTS
Is Marker For: Genes:   Srpr   Zzef1   Gm6733  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGGCATGTTTGGTATGCTG
Reverse Primer TGGCAACAGATTCACAGAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1557479Zzef1zinc finger, ZZ-type with EF hand domain 1117279615072927120Mouse
2295398Gm6733predicted gene 6733117283346172835383Mouse
1322998Srprsignal recognition particle receptor ('docking protein')93521120335217003Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
10053682Eae45_mexperimental allergic encephalomyelitis susceptibility 45 (mouse)Not determined115859972974863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
1301999Lmr15_mleishmaniasis resistance 15 (mouse)Not determined116342858181939647Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
4142316Ity2b_mimmunity to S. typhimurium 2b (mouse)Not determined116718736579923086Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
1300651Pcyts3_mplasmacytoma susceptibility 3 (mouse)Not determined1170800372104800540Mouse
1301681Sle13_msystematic lupus erythematosus susceptibility 13 (mouse)Not determined1170800372104800540Mouse
1558812Rafar_mretinoic acid induced forelimb autopod reduction (mouse)Not determined1170800372104800540Mouse
4141339Nilac2_mnicotine induced locomotor activity 2 (mouse)Not determined1170800372104800540Mouse
1301404Sbmd4_mspinal bone mineral density 4 (mouse)Not determined1172128823106128908Mouse
1301078Alcp2_malcohol preference locus 2 (mouse)Not determined117231897084840636Mouse
1300849Sles4_msystemic lupus erythmatosus suppressor 4 (mouse)Not determined9910756137395074Mouse
13504833Bglu19_mblood glucose level 19 (mouse)9999947243999472Mouse
1300532Tbs2_mtuberculosis severity 2 (mouse)Not determined91245867446458818Mouse
10043917Obq37_mobesity QTL 37 (mouse)Not determined91347987947479879Mouse
1357637Si5lq2_mserum IGFBP-5 level QTL 2 (mouse)Not determined91550045549500594Mouse
4141447Cfmq2_mcystic fibrosis modifier QTL 2 (mouse)Not determined91550045549500594Mouse
4141591Cq4_mcholesterol QTL 4 (mouse)Not determined91550045549500594Mouse
1301421Lgth4_mbody length 4 (mouse)Not determined91550045549500594Mouse
11354951Pdcc3_mplasmacytoid dentritic cell compartment 3 (mouse)91583833149838331Mouse
12790993Adq1_maortic diameter QTL 1 (mouse)91583833149838331Mouse
12790997Adq2_maortic diameter QTL 2 (mouse)91583833149838331Mouse
12880415V125Dq7_mvitamin D active form serum level QTL 7 (mouse)91610000050100000Mouse
12880416V125Dq8_mvitamin D active form serum level QTL 8 (mouse)91610000050100000Mouse
13504834Hdlq109_mHDL QTL 109 (mouse)91679834550798345Mouse
1357465Vtbt6_mvertebral trabecular bone trait 6 (mouse)Not determined91706754451067647Mouse
1300643Pvcan2_mprotection against vaginal candidiasis 2 (mouse)Not determined92003211054032229Mouse
1301439Morph2_mmorphine antinociception 2 (mouse)Not determined92024206654242196Mouse
1301045Sluc10_msusceptibility to lung cancer 10 (mouse)Not determined92039490154395074Mouse
1301883Skull12_mskull morphology 12 (mouse)Not determined92039490154395074Mouse
4142352Lmr17_mleishmaniasis resistance 17 (mouse)Not determined92039490154395074Mouse
10043950Pbft5_mpercent body fat 5 (mouse)Not determined92039490154395074Mouse
12904939Edlmmq8_mextensor digitorum longus muscle mass QTL 8 (mouse)92094144454941444Mouse
13208563Bmiq8_mbody mass index QTL 8 (mouse)92500000069000000Mouse
11532694Sluc39a_msusceptibility to lung cancer 39a (mouse)92567618959676285Mouse
11532695Sluc39b_msusceptibility to lung cancer 39b (mouse)92567618959676285Mouse
11532696Sluc39c_msusceptibility to lung cancer 39c (mouse)92567618959676285Mouse
11532712Sluc39d_msusceptibility to lung cancer 39d (mouse)92567618959676285Mouse
1300932Hdlq17_mHDL QTL 17 (mouse)Not determined92688512460885255Mouse
10043867Mtbcq9_mmultiple trait body composition QTL 9 (mouse)Not determined92688512460885255Mouse
10043987Stheal13_msoft tissue heal 13 (mouse)Not determined92688512460885255Mouse
10043878Adip20_madiposity 20 (mouse)Not determined92733989761340026Mouse
14700787Ncdq1_mnevus cell density QTL 1 (mouse)92820000036200000Mouse
1301000Obq5_mobesity QTL 5 (mouse)Not determined92859203741888030Mouse
10043847Hdlq89_mHDL QTL 89 (mouse)Not determined92938163163381774Mouse
1301782Chol11_mcholesterol 11 (mouse)Not determined92938163163381774Mouse
1301365Ap5q_malcohol preference 5 QTL (mouse)Not determined93014186664141979Mouse
1558949Igan3_mIgA nephropathy 3 (mouse)Not determined93050339840654618Mouse
1357746Vtbt7_mvertebral trabecular bone trait 7 (mouse)Not determined93082861764828723Mouse
4142455Elnv_mepilepsy naive (mouse)Not determined93136026237395074Mouse
1302180Actd4_mactivity-distance traveled 4 (mouse)Not determined93252326366523557Mouse
4141148Cq5_mcholesterol QTL 5 (mouse)Not determined93254112166541246Mouse
1301692Hts_mhypothermia sensitivity (mouse)Not determined93259987266600121Mouse
4141323Ptnu3_mproteinuria 3 (mouse)Not determined93297840266978536Mouse
1357709Si5lq3_mserum IGFBP-5 level QTL 3 (mouse)Not determined93319972567199840Mouse
1558872Ibdq1_minflammatory bowel disease QTL 1 (mouse)Not determined93406754473531973Mouse
1357682Phdlc1_mplasma HDL cholesterol 1 (mouse)Not determined93419332342853570Mouse
1300868Tlf_mT lymphocyte fraction (mouse)Not determined93492645237395074Mouse
1301252Etohc3_methanol consumption 3 (mouse)Not determined93512317869123299Mouse
1301972Cocrb8_mcocaine related behavior 8 (mouse)Not determined93512317869123299Mouse
1558968Tbdr1_mbody temperature response to dietary restriction, QTL 1 (mouse)Not determined93512317869123299Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 195018 UniSTS
  627119 UniSTS
  67398 UniSTS
UniSTS 155977 UniSTS