Chst2 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Chst2

Symbol: Chst2
Also known as:
RGD ID: 4978430
Expected Size: 368 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38995,405,114 - 95,405,481UniSTSGRCm38
MGSCv37995,305,533 - 95,305,900UniSTSGRCm37
Celera994,969,147 - 94,969,514UniSTS
Cytogenetic Map9E3.2-3.3UniSTS
cM Map9 UniSTS
Is Marker For: Genes:   Chst2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTCGTCGGACTGGTGGACGA
Reverse Primer CCCAGAGCGTGGTAGTCTGC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4412473 UniSTS
NCBI Gene 54371 UniSTS
UniGene Mm.212446 UniSTS
UniSTS 527288 UniSTS