D5S1606E Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D5S1606E

Symbol: D5S1606E
Also known as:
RGD ID: 4974368
Expected Size: 163 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381860,776,412 - 60,776,952UniSTSGRCm38
GRCm381581,972,399 - 81,972,561UniSTSGRCm38
MGSCv371581,802,829 - 81,802,991UniSTSGRCm37
MGSCv371860,936,066 - 60,936,606UniSTSGRCm37
Celera1862,060,191 - 62,060,731UniSTS
Celera1584,094,731 - 84,094,893UniSTS
Cytogenetic Map18E1UniSTS
Cytogenetic Map15E1UniSTS
cM Map1830.0UniSTS
Is Marker For: Genes:   Rps14   Gm5805  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGTCACACGGCAGATGG
Reverse Primer CGAAAGGGGAAGGAAAAGAAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
62317Rps14ribosomal protein S14186077459660778546Mouse
1620354Gm5805predicted gene 5805158197237381972897Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
27226723Tibw9_mtibia width 9, proximal, 16 week (mouse)18320000060800000Mouse
1558849W3q15_mweight 3 weeks QTL 15 (mouse)Not determined18504111961139571Mouse
1357603Mom3_mmodifier of Min 3 (mouse)Not determined181389696666965891Mouse
25823173Hrsq12_mhost response to SARS QTL 12, hemorrhage (mouse)182476282478296340Mouse
1301400Lmr13_mleishmaniasis resistance 13 (mouse)Not determined182797631361976451Mouse
4141857Mhysq5_mmale hybrid sterility QTL 5 (mouse)Not determined2799753761997672Mouse
1302163Bmd16_mbone mineral density 16 (mouse)Not determined182953484763534993Mouse
12880412V125Dq12_mvitamin D active form serum level QTL 12 (mouse)183010000064100000Mouse
1300685Scc5_mcolon tumor susceptibility 5 (mouse)Not determined183185541365855562Mouse
1357690Vtbt19_mvertebral trabecular bone trait 19 (mouse)Not determined183295797666958154Mouse
1301771Pcyts6_mplasmacytoma susceptibility 6 (mouse)Not determined183552556069525779Mouse
4142366Chlq10_mcirculating hormone level QTL 10 (mouse)Not determined183615795070158108Mouse
15039381Ltgq8_mliver triglyceride QTL 8 (mouse)183807349772073497Mouse
15039383Mvlq5_mmicrovesicular liver lesion QTL 5 (mouse)183807349772073497Mouse
15039384Liviq1_mliver inflammation QTL 1 (mouse)183807349772073497Mouse
15039386Mvlq4_mmacrovesicular liver lesion QTL 4 (mouse)183807349772073497Mouse
12050070Nabq2_mnasal bone morphology QTL 2 (mouse)183897060572970721Mouse
1357639Obsty4_mobesity 4 (mouse)Not determined183948686184620653Mouse
1301902Hrtfm4_mheart failure modifier 4 (mouse)Not determined184317804877178271Mouse
1301215Thcr_mT helper cell response (mouse)Not determined184499753768645706Mouse
12904745Carcdq2_mcardiac collagen deposition QTL 2 (mouse)184629021680290216Mouse
11039493Ltpr8d_mLeishmania tropica response 8d (mouse)184674183280741971Mouse
11039494Ltpr8b_mLeishmania tropica response 8b (mouse)184674183280741971Mouse
27226720Tibw5_mtibia width 5, proximal, 10 week (mouse)185030000062500000Mouse
1357630Tgq1_mtriglyceride QTL 1 (mouse)Not determined185091908584919240Mouse
11252137Modvl5_mmodifier of vacuolated lens 5 (mouse)185091908584919240Mouse
1302099Hdlq30_mHDL QTL 30 (mouse)Not determined185153522985535397Mouse
10412244Par5_mpulmonary adenoma resistance 5 (mouse)Not determined185153522985535397Mouse
1301853Heal9_mwound healing/regeneration 9 (mouse)Not determined185267220586672345Mouse
1302050Radpf4_mradiation pulmonary fibrosis 4 (mouse)Not determined185283308468645706Mouse
4142443Pgis1_mproteoglycan induced spondylitis 1 (mouse)Not determined185315795076826598Mouse
4141431Msmr2_mMSM lymphoma resistance 2 (mouse)Not determined5484280161105798Mouse
1301500Szs4_mseizure susceptibility 4 (mouse)Not determined185484280185496018Mouse
12880410V125Dq13_mvitamin D active form serum level QTL 13 (mouse)185630000090300000Mouse
12880430Fgf23lq4_mFGF23 serum level QTL 4 (mouse)185630000090300000Mouse
10412183Sstapa2_mSuseptibility to Staphylococus aureus infection 2 (mouse)Not determined185666155866819414Mouse
12880428V125Dq14_mvitamin D active form serum level QTL 14 (mouse)185730000090702639Mouse
1301353Lbw6_mlupus NZB x NZW 6 (mouse)Not determined185742926790702639Mouse
4141132Eae18_mexperimental allergic encephalomyelitis susceptibility 18 (mouse)Not determined5745748782586603Mouse
4140971Mbmq1_mmale body mass QTL 1 (mouse)Not determined5785721090702639Mouse
12910791Pwgrq8_mpre-weaning growth rate QTL 8 (mouse)185788832769216071Mouse
11039492Ltpr8a_mLeishmania tropica response 8a (mouse)185904702190702639Mouse
11039495Ltpr8c_mLeishmania tropica response 8c (mouse)185904702190702639Mouse
11049564Lmr29_mleishmaniasis resistance 29 (mouse)185904702190702639Mouse
1301103Pgia11_mproteoglycan induced arthritis 11 (mouse)Not determined185982648990702639Mouse
1302109Sluc28_msusceptibility to lung cancer 28 (mouse)Not determined185984762690702639Mouse
38455998Cdtm1_mCD62L+ CD8 TM cells 1 (mouse)186000000080000000Mouse
27226734Tibmd5_mtibia midshaft diameter 5, 10 week (mouse)15610000086800000Mouse
26884442Sklq6_mskull length QTL 6, 5 week (mouse)156100000100900000Mouse
27226777Tibl8_mtibia length 8, 5 week (mouse)15690000084700000Mouse
1357526Hyplip2_mhyperlipidemia 2 (mouse)Not determined1512402117102988123Mouse
26884425Cvht2_mcranial vault height 2, 5 week (mouse)1528800000102100000Mouse
1558985Eae32_mexperimental allergic encephalomyelitis susceptibility 32 (mouse)Not determined1532578270103517472Mouse
27226729Tibmd2_mtibia midshaft diameter 2, 5 week (mouse)153800000086800000Mouse
26884402Cvht9_mcranial vault height 9, 16 week (mouse)154230000095600000Mouse
1300644Fob3_mF-line obesity QTL 3 (mouse)11.3Not determined154414443889377036Mouse
26884397Humsd5_mhumerus midshaft diameter 5, 10 week (mouse)154850000098500000Mouse
26884399Humsd1_mhumerus midshaft diameter 1, 5 week (mouse)1548500000101800000Mouse
1301429Pcir3_mperiosteal circumference 3 (mouse)Not determined154859351382593647Mouse
4142198Hbtq_mhabituation QTL (mouse)Not determined155128885985288984Mouse
10045637Heal27_mwound healing/regeneration 29 (mouse)Not determined155154651285546662Mouse
10412067Pain2_mpain 2 (mouse)Not determined155177349085773777Mouse
1302080Szs13_mseizure susceptibility 13 (mouse)Not determined155181398385822600Mouse
1301708Cocrb14_mcocaine related behavior 14 (mouse)Not determined155193466685934802Mouse
38501067Tip3_mtuberculosis immunophenotype 3, IFN-g level (mouse)155370000089700000Mouse
13504731Cath5_mcarotid atherosclerosis 5 (mouse)155491728088917280Mouse
1302074Bmd4_mbone mineral density 4 (mouse)Not determined1556323312103517472Mouse
27095936Ulnl4_mulna length 4, 5 week (mouse)155690000087800000Mouse
1300800Ses3_msalmonella enteritidis susceptibility 3 (mouse)Not determined155724515691245304Mouse
1357407Pfat4_mpredicted fat percentage 4 (mouse)8.6Body fat amountpredicted fat percentage155724515691245304Mouse
12880420V25Dq8_mvitamin D inactive form serum level QTL 8 (mouse)156170000095700000Mouse
1301601Faq9_mfluctuating asymmetry QTL 9 (mouse)Not determined156327970297279794Mouse
1302197Bhr2_mbronchial hyperresponsiveness 2 (mouse)Not determined1564434485103517472Mouse
4141135Cia35_mcollagen induced arthritis 35 (mouse)Not determined156492762598927745Mouse
1301119Drb7_mdopamine receptor binding 7 (mouse)Not determined156545237799456827Mouse
1301171Brm2_mbrachyury modifier 2 (mouse)Not determined156564117599641298Mouse
4141921Pstc3_mperiosteal circumference 3 (mouse)Not determined1567386497101386646Mouse
1300627Sluc26_msusceptibility to lung cancer 26 (mouse)Not determined1570461452104043685Mouse
1300726Pitm4_mprion incubation time 4 (mouse)Not determined1570465070104043685Mouse
1300648Dbsty4_mdiabesity 4 (mouse)Not determined1570465070104043685Mouse
14747011Mancz13_mmandible centroid size 13 (mouse)1572498466104043685Mouse
12791003Aath8_maortic arch atherosclerosis 8 (mouse)1573545941104043685Mouse
15092079Igly6_mIgG glycosylation 6, GP6 (mouse)157422869182789955Mouse
1301472Pain1_mpain 1 (mouse)Not determined157544899790928982Mouse
1300851Heal4_mwound healing/regeneration 4 (mouse)Not determined1577629711104043685Mouse
15092080Igly7_mIgG glycosylation 7, GP10 (mouse)157791071982789955Mouse
4142060W3q6_mweight 3 weeks QTL 6 (mouse)Not determined78716903102993272Mouse
1357894Epfpq3_mepididymal fat percentage QTL 3 (mouse)Not determined1578716903102993272Mouse
14928306Manh79_mmandible shape 79 (mouse)1578949676104043685Mouse
12880411V125Dq11_mvitamin D active form serum level QTL 11 (mouse)1579000000104043685Mouse
10402490Dipa5_mdrug induced psychomotor activation 5 (mouse)Not determined1579265530104043685Mouse
4141897Imrfq2_mimmune response to Factor IX QTL 2 (mouse)Not determined80011059104043685Mouse
1301284Cosz3_mcocaine seizure 3 (mouse)Not determined1580415753104043685Mouse
4141902Cia37_mcollagen induced arthritis 37 (mouse)Not determined1580987052104043685Mouse
1300974Pgia9_mproteoglycan induced arthritis 9 (mouse)Not determined1580987052104043685Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 101056544 UniSTS
  20044 UniSTS
  545121 UniSTS
UniGene Mm.309697 UniSTS
  Mm.432200 UniSTS
  Mm.43778 UniSTS
  Mm.459366 UniSTS
UniSTS 151027 UniSTS