Rhoa Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Rhoa

Symbol: Rhoa
Also known as: NoName; 
RGD ID: 4970947
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389108,337,459 - 108,337,875UniSTSGRCm38
GRCm38264,866,865 - 64,867,364UniSTSGRCm38
Celera9107,946,561 - 107,946,977UniSTS
Celera266,537,733 - 66,538,236UniSTS
Cytogenetic Map9F2UniSTS
Cytogenetic Map9F1UniSTS
Is Marker For: Genes:   Rhoa   Gpx1   Gm19725  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGTCATTCCCACAGAAAGTG
Reverse Primer AGTCAGCTGGAGAGAAGAGACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
731060Rhoaras homolog family member A9108306160108337943Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1301725Lifespan1_mlife span 1 (mouse)Not determined974368177108368325Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse
1301769Orgwq2_morgan weight QTL 2 (mouse)Not determined2388608993591306Mouse
8552707Cia23_mcollagen induced arthritis QTL 23 (mouse)Not determined21212472666726109Mouse
1357454Kidq1_mkidney weight QTL 1 (mouse)Not determined220892967119064359Mouse
1357436Splq1_mspleen weight QTL 1 (mouse)Not determined220892967119064359Mouse
1357829Lvrq1_mliver weight QTL 1 (mouse)Not determined220892967119064359Mouse
1558899Egq1_mearly growth QTL 1 (mouse)Not determined220892967119064359Mouse
1558738W6q1_mweight 6 weeks QTL 1 (mouse)Not determined220892967119064359Mouse
1558966W10q9_mweight 10 weeks QTL 9 (mouse)Not determined220892967119064359Mouse
1558915W3q1_mweight 3 weeks QTL 1 (mouse)Not determined220892967119064359Mouse
1357681Hrtq1_mheart weight QTL 1 (mouse)Not determined220892967119064359Mouse
1357881Estoq1_membryo survival total QTL 1 (mouse)Not determined220892967119064359Mouse
39128209Lwq14_mliver weight QTL 14 (mouse)220892967119064359Mouse
1302174Dssc2_mdextran sodium sulfate induced colitis QTL2 (mouse)Not determined224334620148858457Mouse
1300577Capsq1_mcapsaicin sensitivity related QTL 1 (mouse)Not determined22771204884183040Mouse
4141854T2dm2sa_mtype 2 diabetes mellitus 2 in SMXA RI mice (mouse)Not determined229417935148533014Mouse
4141236Hbnr5_mHeligmosomoides bakeri nematode resistance 5 (mouse)Not determined31324555105313225Mouse
4142447Pbwg1.7_mpostnatal body weight growth 1.7 (mouse)Not determined3590731269907394Mouse
4141186Pbwg1.8_mpostnatal body weight growth 1.8 (mouse)Not determined3590731269907394Mouse
4142133Pbwg1.6_mpostnatal body weight growth 1.6 (mouse)Not determined3590731269907394Mouse
1559001Eae33_mexperimental allergic encephalomyelitis susceptibility 33 (mouse)Not determined23610166771779068Mouse
10449145Lanq1_mlanosterol level QTL 1 (mouse)23823971367242263Mouse
10449150Pvldlc1_mplasma VLDL-cholesterol 1 (mouse)23823971367242263Mouse
10449151Hdl8_mhigh density lipoprotein (HDL) level 8 (mouse)23823971367242263Mouse
11038703Ltpr1_mLeishmania tropica response 1 (mouse)24008165374081799Mouse
1301109Dntcs2_mdental caries susceptibility 2 (mouse)Not determined240995481115079684Mouse
1301480Pbwg1_mpostnatal body weight growth 1 (mouse)Not determined24193070775930831Mouse
1301411Pitm1_mprion incubation time 1 (mouse)Not determined24369026877690412Mouse
4141069Pbwg1.5_mpostnatal body weight growth 1.5 (mouse)Not determined4369026877690412Mouse
1301402Ap2q_malcohol preference 2 QTL (mouse)Not determined24369026877690412Mouse
1300788Cia2_mcollagen induced arthritis QTL 2 (mouse)Not determined24369026877690412Mouse
1300671Cia4_mcollagen induced arthritis QTL 4 (mouse)Not determined24369026877690412Mouse
10755532Lymph5_mlymphocyte differential 5 (mouse)24436867378368673Mouse
1300645Alcp1_malcohol preference locus 1 (mouse)Not determined24533811668008524Mouse
1301344Lith1_mlithogenic gene 1 (mouse)Not determined245457623145470727Mouse
4141809Pbwg1.1_mpostnatal body weight growth 1.1 (mouse)Not determined4830206882302151Mouse
11532740Pbwg1.10_mpostnatal body weight growth 1.10 (mouse)24830206882302151Mouse
1301235Alcw4_malcohol withdrawal 4 (mouse)Not determined24843940282439590Mouse
1301747Eae21_mexperimental allergic encephalomyelitis 21 (mouse)Not determined24843940282439590Mouse
1302085Mobe1_mmodifier of obesity 1 (mouse)Not determined24843940282439590Mouse
1300568Hdl1_mhigh density lipoprotein (HDL) level 1 (mouse)Not determined24843940282439590Mouse
1558820Moo1_mmodifier of Odc1 (mouse)Not determined174843940282439590Mouse
10755526Lymph1_mlymphocyte differential 1 (mouse)25098897084988970Mouse
1300875Taste1_mtaste-saccharin preference 1 (mouse)Not determined25109283185092934Mouse
1300761Lgth1_mbody length 1 (mouse)Not determined25187293285873081Mouse
13464141Hbbcq3_mhemoglobin concentration QTL 3 (mouse)25261767586617792Mouse
13463471Hctq6_mhematocrit QTL 6 (mouse)25261767586617792Mouse
4142299Pbwg1.4_mpostnatal body weight growth 1.4 (mouse)Not determined5562407289624172Mouse
4142185Pbwg1.3_mpostnatal body weight growth 1.3 (mouse)Not determined5729711165302151Mouse
4141406Alpq2_malcohol preference QTL 2 (mouse)Not determined25769377391693944Mouse
12738429Lfibq18_mliver fibrosis QTL 18 (mouse)25808964792089647Mouse
1357577Trmq3_mT cell ratio modifier QTL 3 (mouse)Not determined260690268119525037Mouse
13824983Vclq1_mcurvilinear velocity QTL 1 (mouse)262000000137000000Mouse
1300662Etohila_methanol induced locomotor activity (mouse)Not determined26317561097175769Mouse
1301405Etohr_methanol response acute (mouse)Not determined26317561097175769Mouse
1301703Bomd3_mbone mineral density 3 (mouse)Not determined26317561097175769Mouse
10044002Hdl7_mHDL level 7 (mouse)Not determined26317561097175769Mouse
10053681Lith24_mlithogenic gene 24 (mouse)Not determined26317561097175769Mouse
1301048Actre2_mactivity response to ethanol 2 (mouse)Not determined26317561097175769Mouse
1301873Hsl1_mhyperoxia susceptibility locus 1 (mouse)Not determined26373981097739957Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:4888341 UniSTS
NCBI Gene 100503492 UniSTS
  11848 UniSTS
  14775 UniSTS
UniGene Mm.757 UniSTS
UniSTS 532286 UniSTS