Supt4h Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Supt4h

Symbol: Supt4h
Also known as: Supt4a; Supt4h1; Supt4h2; 
RGD ID: 4966886
Expected Size: 64 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381031,413,900 - 31,413,963UniSTSGRCm38
GRCm381187,742,822 - 87,743,091UniSTSGRCm38
MGSCv371187,556,324 - 87,556,593UniSTSGRCm37
MGSCv371031,133,706 - 31,133,769UniSTSGRCm37
Celera1032,338,378 - 32,338,441UniSTS
Celera1197,338,358 - 97,338,627UniSTS
Cytogenetic Map10A4UniSTS
Cytogenetic Map11CUniSTS
Cytogenetic Map10A4-B2UniSTS
cM Map1149.0UniSTS
cM Map1152.2UniSTS
Is Marker For: Genes:   Tpd52l1   Supt4a  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACAGCTGGGTCTCCAAGTGG
Reverse Primer ACGGACACAGCATATACACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1623282Supt4aSPT4A, DSIF elongation factor subunit118773755187743623Mouse
1320808Tpd52l1tumor protein D52-like 1103133237331445987Mouse
1314952Supt4bSPT4B, DSIF elongation factor subunit103141372631414435Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
1300651Pcyts3_mplasmacytoma susceptibility 3 (mouse)Not determined1170800372104800540Mouse
1301681Sle13_msystematic lupus erythematosus susceptibility 13 (mouse)Not determined1170800372104800540Mouse
1558812Rafar_mretinoic acid induced forelimb autopod reduction (mouse)Not determined1170800372104800540Mouse
4141339Nilac2_mnicotine induced locomotor activity 2 (mouse)Not determined1170800372104800540Mouse
1301404Sbmd4_mspinal bone mineral density 4 (mouse)Not determined1172128823106128908Mouse
1301310Tmevd5_mTheiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse)Not determined1172835299106835463Mouse
4142348Pstc2_mperiosteal circumference 2 (mouse)Not determined1172927789106927907Mouse
10043866Adip19_madiposity 19 (mouse)Not determined1172927789106927907Mouse
11038695Par8_mpulmonary adenoma resistance 8 (mouse)1177172953111173092Mouse
1301414Heal10_mwound healing/regeneration 10 (mouse)Not determined1177546357111546496Mouse
10045616Heal25_mwound healing/regeneration 25 (mouse)Not determined1177546357111546496Mouse
1302124Eae7_msusceptibility to experimental allergic encephalomyelitis 7 (mouse)Not determined117768304799486994Mouse
10413882Moe1_mmodifier of epilepsy 1 (mouse)1177880152111880273Mouse
1301640Lore4_mloss of righting induced by ethanol 4 (mouse)Not determined1179265183107725646Mouse
14746970Manh71_mmandible shape 71 (mouse)1179525431113525431Mouse
10043865T2dm5sa_mtype 2 diabetes mellitus 5 in SMXA RI mice (mouse)Not determined1179922933104611872Mouse
27226758Femd3_mfemur midshaft diameter 3, 5 week (mouse)1181000000102000000Mouse
1300649Crhq1_mcompensatory renal hypertrophy QTL 1 (mouse)Not determined1181683655115683810Mouse
1300766Skull16_mskull morphology 16 (mouse)Not determined1181683655115683810Mouse
10412288Carg4_mCandida albicans resistance gene 4 (mouse)Not determined1181919441115919441Mouse
1301072Eae22_mexperimental allergic encephalomyelitis 22 (mouse)Not determined1182486872116486994Mouse
14747003Mancz9_mmandible centroid size 9 (mouse)1185954085119954085Mouse
15039374Adip29_madiposity 29 (mouse)1186717494120717494Mouse
15039376Bw42_mbody weight QTL 42 (mouse)1186717494120717494Mouse
15014785Mvlq1_mmacrovesicular liver lesion QTL 1 (mouse)1186717494120717494Mouse
27226789Feml16_mfemur length 16, 10 week (mouse)1187600000126900000Mouse
10044007Hbnr14_mHeligmosomoides bakeri nematode resistance 14 (mouse)Not determined1187611774121611872Mouse
15039341Nmrs28_mNAFLD-associated magnetic resonance shift 28 (mouse)1047525334475253Mouse
1357813Ath20_matherosclerosis 20 (mouse)Not determined10340743937407588Mouse
1300790Pgia6_mproteoglycan induced arthritis 6 (mouse)Not determined10393427237934396Mouse
1300997Eae15_msusceptibility to experimental allergic encephalomyelitis 15 (mouse)Not determined10453225538532377Mouse
13208561Wght8_mweight 8 (mouse)10500000044000000Mouse
1302092Ath11_matherosclerosis 11 (mouse)Not determined10620194558857699Mouse
1357740Obsty3_mobesity 3 (mouse)Not determined108359714116355075Mouse
1558865Lith21_mlithogenic gene 21 (mouse)Not determined10864910542649228Mouse
1302133Alcp16_malcohol preference locus 16 (mouse)Not determined101001426844014395Mouse
1301129Alcp15_malcohol preference locus 15 (mouse)Not determined101001426844014395Mouse
1301448Pas11_mpulmonary adenoma susceptibility 11 (mouse)Not determined101001426844014395Mouse
1301386Sysbp1_msystolic blood pressure 1 (mouse)Not determined101023252187565233Mouse
1357825Kidpq2_mkidney weight percentage QTL 2 (mouse)Not determined101282830784243920Mouse
1357656Hrtq3_mheart weight QTL 3 (mouse)Not determined101282830784243920Mouse
1357864Scfpq1_msubcutaneous fat pad percentage QTL 1 (mouse)Not determined101282830784243920Mouse
1357893Lvrq4_mliver weight QTL 4 (mouse)Not determined101282830784243920Mouse
4142380W3q11_mweight 3 weeks QTL 11 (mouse)Not determined1282830784243920Mouse
4141943W6q6_mweight 6 weeks QTL 6 (mouse)Not determined1282830784243920Mouse
4141956Egq7_mearly growth QTL 7 (mouse)Not determined1282830784243920Mouse
4142272W10q5_mweight 10 weeks QTL 5 (mouse)Not determined1282830784243920Mouse
39128215Lwq17_mliver weight QTL 17 (mouse)101282830784243920Mouse
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
10755518Chol16_mcholesterol 16 (mouse)101903904753039047Mouse
1302160Mbis2_mMycobacterium bovis-induced systemic lupus erythematosus 2 (mouse)Not determined102040743956155127Mouse
1558757Eae34_mexperimental allergic encephalomyelitis susceptibility 34 (mouse)Not determined1021532255114381325Mouse
1301003Lmblgq4_mlimb length QTL 4 (mouse)Not determined102171529368255809Mouse
26884394Humsd3_mhumerus midshaft diameter 3, 10 week (mouse)102250000051200000Mouse
26884403Cvht8_mcranial vault height 8, 16 week (mouse)102300000091200000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
4142209Psrs1_mpsoriasis susceptibility 1 (mouse)Not determined102701426846844387Mouse
1300898Cfid_mcystic fibrosis intestinal distress (mouse)Not determined102984430763844387Mouse
10045632Heal16_mwound healing/regeneration 16 (mouse)Not determined103109840365098534Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1336264 UniSTS
NCBI Gene 100041294 UniSTS
  20922 UniSTS
  21987 UniSTS
UniSTS 144522 UniSTS