Rnf35 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: Rnf35

Symbol:

Rnf35

Also known as:

Trim61;

RGD ID:

4966879

Expected Size:

534 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	8	65,013,256 - 65,013,790	UniSTS	GRCm38
MGSCv37	8	67,537,155 - 67,537,689	UniSTS	GRCm37
Celera	8	67,574,641 - 67,575,175	UniSTS
Cytogenetic Map	8	B3.1-3.2	UniSTS
cM Map	8		UniSTS

Is Marker For:

Genes: Trim60 Trim61

Annotation

References - curated


1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	ACAGAATTATCAAGCGATTTCAAG
Reverse Primer	GGCTCGTAGTCATATCCAGTGTAG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1621318	Trim60	tripartite motif-containing 60	8	64998448	65018688	Mouse
1621996	Trim61	tripartite motif-containing 61	8	65012976	65018688	Mouse

Nucleotide Sequences


RefSeq Transcripts	NM_001177551	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_153110	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC102287	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AY063495	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AY063497	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC064738	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	GL589899	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1558870	Eae36_m	experimental allergic encephalomyelitis susceptibility 36 (mouse)			Not determined		8	14723160	71045600	Mouse
1357811	Orq3_m	ovulation rate QTL 3 (mouse)			Not determined		8	32016544	71287993	Mouse
4141437	W10q14_m	weight 10 weeks QTL 14 (mouse)			Not determined			32016544	71287993	Mouse
4141172	W6q9_m	weight 6 weeks QTL 9 (mouse)			Not determined			32016544	71287993	Mouse
4140966	Egq12_m	early growth QTL 12 (mouse)			Not determined			32016544	71287993	Mouse
4140967	Bmd39_m	bone mineral density 39 (mouse)			Not determined		8	32016544	117238700	Mouse
1301936	Trigq2_m	triglyceride QTL 2 (mouse)			Not determined		8	33837362	67837502	Mouse
1558875	Eae31_m	experimental allergic encephalomyelitis susceptibility 31 (mouse)			Not determined		8	34642776	114837007	Mouse
1301013	Capsq4_m	capsaicin sensitivity related QTL 4 (mouse)			Not determined		8	36163000	92728652	Mouse
27226754	Femd6_m	femur midshaft diameter 6, 10 week (mouse)					8	37400000	109600000	Mouse
12904744	Carcdq1_m	cardiac collagen deposition QTL 1 (mouse)					8	39709256	94689598	Mouse
1301544	Iba3_m	induction of brown adipocytes 3 (mouse)			Not determined		8	44294880	78295025	Mouse
1301717	Adip4_m	adiposity 4 (mouse)			Not determined		8	47637030	81637146	Mouse
10766453	Char11_m	P. chabaudi malaria resistance QTL 11 (mouse)					8	47637030	81637146	Mouse
1301441	Skull11_m	skull morphology 11 (mouse)			Not determined		8	47737134	81737254	Mouse
1357715	Alaa3_m	alopecia areata 3 (mouse)			Not determined		8	48792939	82793021	Mouse
14746987	Manh64_m	mandible shape 64 (mouse)					8	50053306	84053306	Mouse
14747005	Mancz7_m	mandible centroid size 7 (mouse)					8	50053306	84053306	Mouse
14700686	Civq3_m	cerebral infarct volume QTL 3 (mouse)					8	51882191	85882191	Mouse
1301506	Aevm1_m	autoimmune extremity vasculitis in MRL mice 1 (mouse)			Not determined		8	54287817	88287993	Mouse
1301952	Im3_m	immunoregulatory 3 (mouse)			Not determined		8	54706614	88706763	Mouse
10412287	Carg3_m	Candida albicans resistance gene 3 (mouse)			Not determined		8	55545028	89545028	Mouse
11353828	Gf7_m	gonadal fat pad weight 7 (mouse)					8	58201479	92201479	Mouse
10043975	Obq31_m	obesity QTL 31 (mouse)			Not determined		8	58409776	92409776	Mouse
1301688	Orch6_m	autoimmune orchitis resistance 6 (mouse)			Not determined		8	60786850	94786976	Mouse
4141285	Tgq18_m	triglyceride QTL 18 (mouse)			Not determined			63460107	97460107	Mouse
4141797	Skmw16_m	skeletal muscle weight 16 (mouse)			Not determined		8	63939547	97939696	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
MGD	MGI:2656738	UniSTS
NCBI Gene	234329	UniSTS
	260296	UniSTS
UniGene	Mm.28010	UniSTS
UniSTS	256957	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description: