UniSTS:225121 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:225121

Symbol: UniSTS:225121
Also known as:
RGD ID: 4964727
Expected Size: 182 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm386108,739,197 - 108,739,378UniSTSGRCm38
MGSCv376108,689,191 - 108,689,372UniSTSGRCm37
Celera6110,543,148 - 110,543,329UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGCCCTTCTCAGCAGTTA
Reverse Primer ATATCCATGGGGAACACGAA
 

Region



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1300704Cia3_mcollagen induced arthritis QTL 3 (mouse)Not determined696347325130347522Mouse
11040599Lmr4b_mleishmaniasis resistance 4b (mouse)696347325130347522Mouse
4141940W6q5_mweight 6 weeks QTL 5 (mouse)Not determined96655951146633626Mouse
4142416Egq11_mearly growth QTL 11 (mouse)Not determined96655951146633626Mouse
1357555Tesq2_mtestis weight QTL 2 (mouse)Not determined696655951146633626Mouse
10043923Bhr7_mbronchial hyperresponsiveness 7 (mouse)Not determined698242853132242977Mouse
1301518Bbaa5_mB.burgdorferi-associated arthritis 5 (mouse)Not determined698506837145935444Mouse
1301923Lith6_mlithogenic gene 6 (mouse)Not determined698717516132717715Mouse
1301915Chab3_mcholesterol absorption 3 (mouse)Not determined698931748132940036Mouse
1302131Bmd8_mbone mineral density 8 (mouse)Not determined699155128133155267Mouse
1300887Pabr1_mplasma apolipoprotein B (human) regulator 1 (mouse)Not determined6103777444136423692Mouse
12910776Hcga4b_mhome cage activity 4b (mouse)6104503360110960065Mouse
1301509Sluc3_msusceptibility to lung cancer 3 (mouse)Not determined6104503360127042975Mouse
1357806Aaj3_manxiety in A/J 3 (mouse)Not determined6104503360136423692Mouse
1357793Pnhdlc1_mplasma non-HDL cholesterol 1 (mouse)Not determined6105564822114368849Mouse
4141699Ibdq2_minflammatory bowel disease QTL 2 (mouse)Not determined106005405120917141Mouse


Additional Information

Database Acc Id Source(s)
UniSTS 225121 UniSTS