RH137304 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH137304

Symbol: RH137304
Also known as:
RGD ID: 4962362
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38198,149,000 - 8,149,151UniSTSGRCm38
GRCm389106,880,757 - 106,880,912UniSTSGRCm38
MGSCv379106,783,088 - 106,783,243UniSTSGRCm37
MGSCv37198,223,490 - 8,223,641UniSTSGRCm37
Celera197,907,676 - 7,907,827UniSTS
Celera9106,504,817 - 106,504,971UniSTS
Cytogenetic Map9F1UniSTS
Is Marker For: Genes:   Dcaf1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGATTTGTAATTTCCACATTGGG
Reverse Primer CAGGCAGCAGTCAGTCATGTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1313049Dcaf1DDB1 and CUL4 associated factor 19106814169106880992Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300776Lfp3_mlong free running period 3 (mouse)Not determined19120278703Mouse
4142161Drinksac2_mdrink saccharin 2 (mouse)Not determined120645286Mouse
4142302Nstr1_mnerve sheath tumor resistance QTL 1 (mouse)Not determined19122321310Mouse
1301271Datd_mdopamine transporter density (mouse)Not determined19132362870Mouse
4142406Pbctlp1_mperipheral blood cytotoxic T lymphocyte percentage 1 (mouse)Not determined132897810Mouse
1300904Chab5_mcholesterol absorption 5 (mouse)Not determined19167640035676563Mouse
26884385Skwq14_mskull length QTL 14, 16 week (mouse)19320000035900000Mouse
1357819Tgct2_mtesticular germ cell tumor 2 (mouse)Not determined19327855120562299Mouse
1300923Bits4_mbitterness sensitivity 4 (mouse)Not determined19334585237345984Mouse
1301800Faq10_mfluctuating asymmetry QTL 10 (mouse)Not determined19334585237345984Mouse
1300591Pas3_mpulmonary adenoma susceptibility 3 (mouse)Not determined19334585237345984Mouse
1302126Skull26_mskull morphology 26 (mouse)Not determined19334585237345984Mouse
25394536Skmw86_mskeletal muscle weight 86, TA (mouse)1950147898980461Mouse
11039522Tbbr4_mTrypanosoma brucei brucei response 4 (mouse)19533596239336106Mouse
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1301573Etohcta8_methanol conditioned taste aversion 8 (mouse)Not determined972977005106977152Mouse
10054068El8_mepilepsy 8 (mouse)Not determined972977005106977152Mouse
1301725Lifespan1_mlife span 1 (mouse)Not determined974368177108368325Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 321006 UniSTS
UniGene Mm.440089 UniSTS
  Mm.489783 UniSTS
UniSTS 219392 UniSTS