D8Ertd563e Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D8Ertd563e

Symbol: D8Ertd563e
Also known as: 1500041J02Rik; 
RGD ID: 4961950
Expected Size: 200 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38881,196,876 - 81,197,075UniSTSGRCm38
GRCm38155,072,356 - 55,072,555UniSTSGRCm38
MGSCv37883,720,775 - 83,720,974UniSTSGRCm37
MGSCv37155,129,200 - 55,129,399UniSTSGRCm37
Celera885,453,368 - 85,453,574UniSTS
Celera155,592,426 - 55,592,625UniSTS
Cytogenetic Map8C2UniSTS
Cytogenetic Map1C1.2UniSTS
cM Map1 UniSTS
cM Map836.0UniSTS
Is Marker For: Genes:   Coq10b   Gm4899  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GACAAATTAACTACTTACTTATCTGTT
Reverse Primer AAGTTGTTTCCCAGATGTACT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1622308Coq10bcoenzyme Q10B15505277055072702Mouse
2295349Gm4899predicted gene 489988119674081198375Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13824984Twq5_mtestis weight QTL 5 (mouse)13000000185000000Mouse
1357475w3q13_mweight 3 weeks QTL 13 (mouse)Not determined12307051073937756Mouse
4142433Hbnr1_mHeligmosomoides bakeri nematode resistance 1 (mouse)Not determined2551111058234112Mouse
11100001Col4a1m1_mcollagen, type IV, alpha 1 modifier 1 (mouse)12551111062907723Mouse
12880409V125Dq1_mvitamin D active form serum level QTL 1 (mouse)12600000060000000Mouse
1357822Lvrq3_mliver weight QTL 3 (mouse)Not determined13472105773937756Mouse
1357759W3q12_mweight 3 weeks QTL 12 (mouse)Not determined13472105773937756Mouse
1357651Lgq5_mlate growth QTL 5 (mouse)Not determined13472105773937756Mouse
1357506W10q6_mweight 10 weeks QTL 6 (mouse)Not determined13472105773937756Mouse
1357524W6q14_mweight 6 weeks QTL 14 (mouse)Not determined13472105773937756Mouse
1357824Estoq4_membryo survival total QTL 4 (mouse)Not determined13472105773937756Mouse
39128207Lwq16_mliver weight QTL 16 (mouse)13472105773937756Mouse
1357753Kidq2_mkidney weight QTL 2 (mouse)Not determined134721057150318120Mouse
1357488Splq3_mspleen weight QTL 3 (mouse)Not determined134721057150318120Mouse
1558860W10q7_mweight 10 weeks QTL 7 (mouse)Not determined134721057150318120Mouse
1301954Lrnx11_mlearning-contextual 11 (mouse)Not determined13909372774477206Mouse
1357721Sle17_msystematic lupus erythematosus susceptibility 17 (mouse)Not determined139093727126517573Mouse
12910780Pwgrq11_mpost-weaning growth rate QTL 11 (mouse)14082884867231097Mouse
12910786Pwgrq10_mpost-weaning growth rate QTL 10 (mouse)14082884867231097Mouse
12910788Pwgrq9_mpost-weaning growth rate QTL 9 (mouse)14082884867231097Mouse
1301166Thypr2_mthymocyte proliferative response 2 (mouse)Not determined14123396575234112Mouse
18182931Metl1_mmetabolite locus 1, pyridoxate (mouse)14123624075236240Mouse
4141032Wbcc1_mwhite blood cell count 1 (mouse)Not determined4222050876220508Mouse
1301714Vertcling_mvertical clinging (mouse)Not determined14289887276899008Mouse
12879917Shm3_msperm head morphology 3 (mouse)14414774462907723Mouse
1558855Eae30_mexperimental allergic encephalomyelitis susceptibility 30 (mouse)Not determined14537861372935898Mouse
1301722Cia9_mcollagen induced arthritis QTL 9 (mouse)Not determined145744740189571420Mouse
1301670Ssta1_msusceptibility to Salmonella typhimurium antigens 1 (mouse)Not determined14590759679907723Mouse
1301225Sle7_msystematic lupus erythematosus susceptibility 7 (mouse)Not determined14681553180815680Mouse
1301616Yaa2_mY-linked autoimmune acceleration 2 (mouse)Not determined14681553180815680Mouse
1558905Gct7_mgranulosa cell tumorigenesis 7 (mouse)Not determined14731073581310854Mouse
1558822Vas1_mautoimmune vasitis resistance 1 (mouse)Not determined14884984782850051Mouse
1301211Bbaa11_mB.burgdorferi-associated arthritis 11 (mouse)Not determined14884984782850051Mouse
1301430Cdcs2_mcytokine deficiency colitis susceptibility 2 (mouse)Not determined14885318682853326Mouse
10043965Obq24_mobesity QTL 24 (mouse)Not determined15085105784851057Mouse
4141305Tgq9_mtriglyceride QTL 9 (mouse)Not determined5138244685382446Mouse
4142307Shali1_msurvival time to hyperoxic acute lung injury 1 (mouse)Not determined5192486670367430Mouse
4142291Aec2_mautoimmune exocrinopathy 2 (mouse)Not determined52418578182423027Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
1301099Cbm2_mcerebellum weight 2 (mouse)Not determined878518613112518703Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
12904012Cfq10_mconditioned fear QTL 10 (mouse)88006677589014359Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse
1301581Char2_mP. chabaudi malaria resistance QTL 2 (mouse)Not determined879082178113082403Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
10755530Wbc2_mwhite blood cell count 2 (mouse)881092664115092664Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1862156 UniSTS
NCBI Gene 236010 UniSTS
  52338 UniSTS
  67876 UniSTS
UniGene Mm.281019 UniSTS
  Mm.405038 UniSTS
UniSTS 167578 UniSTS