D11Ertd175e Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Ertd175e

Symbol: D11Ertd175e
Also known as: Nhp2; Nola2; 
RGD ID: 4960898
Expected Size: 218 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381151,623,204 - 51,623,421UniSTSGRCm38
GRCm381062,702,586 - 62,702,813UniSTSGRCm38
MGSCv371151,436,706 - 51,436,923UniSTSGRCm37
MGSCv371062,165,334 - 62,165,561UniSTSGRCm37
Celera1063,804,194 - 63,804,421UniSTS
Celera1156,194,543 - 56,194,764UniSTS
Cytogenetic Map11B1.3UniSTS
Cytogenetic Map10B4UniSTS
cM Map1128.5UniSTS
Is Marker For: Genes:   Nhp2   Rmnd5b   Stox1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CATTTACTTCTATCCCACATTCT
Reverse Primer CTACACCTCTGTGAGAGAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1319778Nhp2NHP2 ribonucleoprotein115161977351623718Mouse
1622111Stox1storkhead box 1106265904362726094Mouse
14999749Gm47261predicted gene, 47261106270221462702829Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
27226798Scvln18_msacral vertebrae length 2, 16 week (mouse)11330000060800000Mouse
26884446Sklq10_mskull length QTL 10, 10 week (mouse)11330000063000000Mouse
26884453Sklq16_mskull length QTL 16, 16 week (mouse)11330000072800000Mouse
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
27226738Metcl11_mmetatarsal-calcaneal length 11, 10 week (mouse)11890000061500000Mouse
26884401Huml4_mhumerus length 4, 10 week (mouse)111160000068600000Mouse
27226762Feml21_mfemur length 21, 16 week (mouse)111180000066100000Mouse
4141966Tailq1_mtail length QTL 1 (mouse)Not determined1231863768609504Mouse
1357851Scfq3_msubcutaneous fat pad weight QTL 3 (mouse)Not determined111231863768609504Mouse
1357437Epfq4_mepididymal fat pad weight QTL 4 (mouse)Not determined111231863768609504Mouse
4141127W3q4_mweight 3 weeks QTL 4 (mouse)Not determined1231863768609504Mouse
4142216Lgq1_mlate growth QTL 1 (mouse)Not determined1231863768609504Mouse
4142308W6q3_mweight 6 weeks QTL 3 (mouse)Not determined111231863768609504Mouse
4141582Lgaq1_mlate growth adjusted QTL 1 (mouse)Not determined1231863768609504Mouse
4142109W10q2_mweight 10 weeks QTL 2 (mouse)Not determined1231863768609504Mouse
4141470Egq4_mearly growth QTL 4 (mouse)Not determined1231863768609504Mouse
1357640Orq2_movulation rate QTL 2 (mouse)Not determined111231863768609504Mouse
1357720Kidpq1_mkidney weight percentage QTL 1 (mouse)Not determined111231863768609504Mouse
1559002Lmrq4_mLeishmania major resistance QTL 4 (mouse)Not determined111231863769794121Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
1558945Orgwq8_morgan weight QTL 8 (mouse)Not determined111710617567187585Mouse
10053687Eae6_msusceptibility to experimental allergic encephalomyelitis 6 (mouse)Not determined111783196668609504Mouse
1300938Bulb3_mbulb size 3 (mouse)Not determined111868778952687889Mouse
12801457Intmrm2_mintima/media ratio modifier 2 (mouse)111868778952687889Mouse
12801459Leuf1_mleukocyte filtration 1 (mouse)111868778952687889Mouse
12801460Intim2_mintima modifier 2 (mouse)111868778952687889Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
1300579Thypr1_mthymocyte proliferative response 1 (mouse)Not determined111939175053391888Mouse
14746971Manh70_mmandible shape 70 (mouse)112001506354015063Mouse
4141398Tgq22_mtriglyceride QTL 22 (mouse)Not determined2127257955272579Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
10044006Hbnr13_mHeligmosomoides bakeri nematode resistance 13 (mouse)Not determined112588179959881914Mouse
1357844Si5lq5_mserum IGFBP-5 level QTL 5 (mouse)Not determined112827504662275149Mouse
13524848Ppiq7_mprepulse inhibition QTL 7 (mouse)112867832062678320Mouse
1301426Desp2_mdespair 2 (mouse)Not determined112881775462817873Mouse
11522752Cocia18_mcocaine-induced activity, QTL 18 (mouse)113111738265117382Mouse
11059563Lmr31_mleishmaniasis resistance 31 (mouse)113220975066209867Mouse
1357782Char8_mP. chabaudi malaria resistance QTL 8 (mouse)Not determined113568778969794161Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
1301788Lbw8_mlupus NZB x NZW 8 (mouse)Not determined113661246070618665Mouse
1301896Tria1_mT-cell receptor induced activation 1 (mouse)Not determined113672273870723028Mouse
4141853Skmw17_mskeletal muscle weight 17 (mouse)Not determined113719011571190238Mouse
4142475Ity2a_mimmunity to S. typhimurium 2a (mouse)Not determined113787775360511890Mouse
10766457Nwa3_mNew Zealand White autoimmunity 3 (mouse)113812528972125383Mouse
1300569Eae6b_msusceptibility to experimental allergic encephalomyelitis 6b (mouse)Not determined114005990154203622Mouse
10053675Eae44b_mexperimental allergic encephalomyelitis susceptibility 44b (mouse)Not determined114005990154203622Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
1300713Vmbic10_mventral midbrain iron content 10 (mouse)Not determined114288179954190238Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
4141770Tcpm1_mT-cell phenotype modifier 1 (mouse)Not determined5156165253725103Mouse
1357740Obsty3_mobesity 3 (mouse)Not determined108359714116355075Mouse
1301386Sysbp1_msystolic blood pressure 1 (mouse)Not determined101023252187565233Mouse
1357825Kidpq2_mkidney weight percentage QTL 2 (mouse)Not determined101282830784243920Mouse
1357656Hrtq3_mheart weight QTL 3 (mouse)Not determined101282830784243920Mouse
1357864Scfpq1_msubcutaneous fat pad percentage QTL 1 (mouse)Not determined101282830784243920Mouse
1357893Lvrq4_mliver weight QTL 4 (mouse)Not determined101282830784243920Mouse
4142380W3q11_mweight 3 weeks QTL 11 (mouse)Not determined1282830784243920Mouse
4141943W6q6_mweight 6 weeks QTL 6 (mouse)Not determined1282830784243920Mouse
4141956Egq7_mearly growth QTL 7 (mouse)Not determined1282830784243920Mouse
4142272W10q5_mweight 10 weeks QTL 5 (mouse)Not determined1282830784243920Mouse
39128215Lwq17_mliver weight QTL 17 (mouse)101282830784243920Mouse
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
1558757Eae34_mexperimental allergic encephalomyelitis susceptibility 34 (mouse)Not determined1021532255114381325Mouse
1301003Lmblgq4_mlimb length QTL 4 (mouse)Not determined102171529368255809Mouse
26884403Cvht8_mcranial vault height 8, 16 week (mouse)102300000091200000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
1300898Cfid_mcystic fibrosis intestinal distress (mouse)Not determined102984430763844387Mouse
10045632Heal16_mwound healing/regeneration 16 (mouse)Not determined103109840365098534Mouse
1357558Bmch4_mbone mechanical trait 4 (mouse)Not determined103170104065701188Mouse
27095920Pglq9_mpelvic girdle length QTL 9, 10 week (mouse)103390000071000000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
4141070Ltgq1_mliver triglyceride QTL 1 (mouse)Not determined4140150475401504Mouse
26884411Bzwq8_mbi-zygomatic width QTL 8, 10 week (mouse)1045000000116100000Mouse
26884407Bzwq14_mbi-zygomatic width QTL 14, 16 wee (mouse)1045600000120800000Mouse
26884421Cvht5_mcranial vault height 5, 10 week (mouse)104570000069300000Mouse
26884400Huml5_mhumerus length 5, 16 week (mouse)104640000069400000Mouse
4142313Angvq1_mangiogenesis by VEGF QTL 1 (mouse)Not determined4684430782655287Mouse
4141159Phl2_mprogressive hearing loss 2 (mouse)Not determined104809840370276821Mouse
1302150Bbaa18_mB.burgdorferi-associated arthritis 18 (mouse)Not determined104950223383502378Mouse
4142169Pbwg16_mpostnatal body weight growth 16 (mouse)Not determined105001240884012633Mouse
1300597Skull14_mskull morphology 14 (mouse)Not determined105001240884012633Mouse
10045641Jckm3_mjuvenile cystic kidney modifier 3 (mouse)Not determined105001240884012633Mouse
1301966Lifespan2_mlife span 2 (mouse)Not determined105001244384012618Mouse
1357737Hpcr2_mhepatocarcinogen resistance 2 (mouse)Not determined105001244384012618Mouse
1300882Ath17_matherosclerosis 17 (mouse)Not determined105125566085255809Mouse
1301502Eae17_msusceptibility to experimental allergic encephalomyelitis 17 (mouse)Not determined105125566085255809Mouse
1301380Cia8_mcollagen induced arthritis QTL 8 (mouse)Not determined105161730482655287Mouse
14746991Manh68_mmandible shape 68 (mouse)105244466786444667Mouse
1301787Bsc1_mbrain size control 1 (mouse)Not determined105868113592681262Mouse
26884450Sklq15_mskull length QTL 15, 16 week (mouse)1059500000122500000Mouse
13208560Wght9_mweight 9 (mouse)1060000000121000000Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1863495 UniSTS
NCBI Gene 216021 UniSTS
  52530 UniSTS
  66089 UniSTS
UniSTS 167045 UniSTS