AI790199 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AI790199

Symbol: AI790199
Also known as: 622577; 
RGD ID: 4959578
Expected Size: 131 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381727,125,147 - 27,125,944UniSTSGRCm38
GRCm389105,545,549 - 105,545,679UniSTSGRCm38
MGSCv379105,447,879 - 105,448,009UniSTSGRCm37
MGSCv371727,262,092 - 27,262,889UniSTSGRCm37
Celera9105,140,981 - 105,141,111UniSTS
Celera1727,661,415 - 27,662,212UniSTS
Cytogenetic Map17B1UniSTS
Cytogenetic Map9F1UniSTS
Whitehead/MRC_RH91089.04UniSTS
Is Marker For: Genes:   Uqcc2   Gm7436  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGTGGACAGGATCAGCTTG
Reverse Primer GGCCTGTGATCAGATGTACG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1315804Uqcc2ubiquinol-cytochrome c reductase complex assembly factor 2172712266527133891Mouse
2295888Gm7436predicted gene 74369105545388105545828Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1302100Circp2_mcircadian photosensitivity 2 (mouse)Not determined17128979566Mouse
12910527Nrq1a_mnoise-induced hearing loss resistant QTL 1a (mouse)17128979566Mouse
12910528Nrq1_mnoise-induced hearing loss resistant QTL 1 (mouse)17128979566Mouse
13524851Asrq8_macoustic startle response 8 (mouse)17130809908Mouse
10412276Leci2_mleukocyte endothelial cell interactions 2 (mouse)Not determined17312791337128037Mouse
1300890Bhr3_mbronchial hyperresponsiveness 3 (mouse)Not determined17392461548559063Mouse
1301327Lmr7_mleishmaniasis resistance 7 (mouse)Not determined17480447727496965Mouse
4141215Mnic1_mmacronutrient intake, carbohydrate 1 (mouse)Not determined480447745359340Mouse
1300706Alan1_malloantigen response 1 (mouse)Not determined17480447746158776Mouse
1357789Kdnw3_mkidney weight 3 (mouse)Not determined17480447747574740Mouse
4141272Tfv1_mtotal food volume 1 (mouse)Not determined480447765330362Mouse
10043949Pbft7_mpercent body fat 7 (mouse)Not determined17667496240674962Mouse
4141608Phl1_mprogressive hearing loss 1 (mouse)Not determined17765701129268449Mouse
1301935Skull24_mskull morphology 24 (mouse)Not determined17836594042366175Mouse
1300787Cd8mts5_mCD8 memory T cell subset 5 (mouse)Not determined17836594042366175Mouse
1301338Lmr1_mleishmaniasis resistance 1 (mouse)Not determined17986241186688972Mouse
1302028Asbb3_mautoimmune susceptibility in C57BL/6J and BALB/c 3 (mouse)Not determined171065914544659245Mouse
4142342Lfnq4_mlung function QTL 4 (mouse)Not determined1098759739053168Mouse
4141067Hbnr2_mHeligmosomoides bakeri nematode resistance 2 (mouse)Not determined1166699745667145Mouse
14747010Mancz14_mmandible centroid size 14 (mouse)171177921045779210Mouse
4142150Stheal11_msoft tissue heal 11 (mouse)Not determined171206732483054339Mouse
12904946Tammq8_mtibialis anterior muscle mass QTL 8 (mouse)171223281346232813Mouse
13524847Asrq8a_macoustic startle response 8a (mouse)171242798746427987Mouse
11081168Tir7_mtrypanosome infection response 7 (mouse)171390439847904522Mouse
1300914Pcir4_mperiosteal circumference 4 (mouse)Not determined171484267848842786Mouse
1558886Lgth9_mbody length 9 (mouse)Not determined171484267848842786Mouse
1302070Tbbmd7_mtotal body bone mineral density 7 (mouse)Not determined171484267848842786Mouse
1300995Fembrs4_mfemur breaking strength 4 (mouse)Not determined171484267848842786Mouse
1302140Wta4_mweight adult 4 (mouse)Not determined171660074750600869Mouse
1302152Skull25_mskull morphology 25 (mouse)Not determined171660074750600869Mouse
1301505Tir1_mtrypanosome infection response 1 (mouse)Not determined171660074750600869Mouse
1302038Radpf1_mradiation pulmonary fibrosis 1 (mouse)Not determined171661519333600869Mouse
10412083Sm2_msusceptibility to Schistosoma mansoni infection 2 (mouse)Not determined171681096950811104Mouse
1302042Acsns3_mAngiostrongylus costaricensis nematode susceptibility 3 (mouse)Not determined171724323451243371Mouse
1300535Char3_mP. chabaudi malaria resistance QTL 3 (mouse)Not determined171724323451243371Mouse
10412214Sxbq3_mSGC/Knj cross B6 QTL 3 (mouse)Not determined171724323451243371Mouse
13452396Leusq3_mleucocytosis susceptibility QTL 3 (mouse)171724323451243371Mouse
13452399Leusq6_mleucocytosis susceptibility QTL 6 (mouse)171724323451243371Mouse
1301840Ssial4_msusceptibility to sialadenitiss 4 (mouse)Not determined171795643651959238Mouse
1301331Lbw1_mlupus NZB x NZW 1 (mouse)Not determined171819938152202007Mouse
1301056Pas2_mpulmonary adenoma susceptibility 2 (mouse)Not determined171820316552205351Mouse
15039354Nmrs36_mNAFLD-associated magnetic resonance shift 36 (mouse)171883413352834133Mouse
1301454Eae5_msusceptibility to experimental allergic encephalomyelitis 5 (mouse)Not determined172430185958301973Mouse
10412198Sst5_msusceptibility to tuberculosis 5 (mouse)Not determined172485760955405969Mouse
10412196Bbaa28_mB.burgdorferi-associated arthritis 28 (mouse)Not determined172536594043665344Mouse
12903990Opfaq5_mopen field activity QTL 5 (mouse)172573195128773124Mouse
10412204Bbaa29_mB.burgdorferi-associated arthritis 29 (mouse)Not determined172574029459740461Mouse
1558758Kcal2_mkilocalorie 2 (mouse)Not determined172618203852604676Mouse
1300602Eye2_meye weight 2 (mouse)Not determined172628636340794146Mouse
1302005Loco2_mlocomotor activity 2 (mouse)Not determined172657408160574223Mouse
12904013Cfq12_mconditioned fear QTL 12 (mouse)172660980730445981Mouse
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1301573Etohcta8_methanol conditioned taste aversion 8 (mouse)Not determined972977005106977152Mouse
10054068El8_mepilepsy 8 (mouse)Not determined972977005106977152Mouse
1301725Lifespan1_mlife span 1 (mouse)Not determined974368177108368325Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 664981 UniSTS
  67267 UniSTS
UniGene Mm.272389 UniSTS
UniSTS 165662 UniSTS