AW049839 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AW049839

Symbol: AW049839
Also known as: 692943; 
RGD ID: 4957736
Expected Size: 86 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389121,852,504 - 121,852,589UniSTSGRCm38
GRCm38385,915,781 - 85,915,866UniSTSGRCm38
MGSCv379121,761,622 - 121,761,707UniSTSGRCm37
MGSCv37385,719,703 - 85,719,788UniSTSGRCm37
Celera9122,327,263 - 122,327,348UniSTS
Celera385,941,815 - 85,941,900UniSTS
Cytogenetic Map9F4UniSTS
Cytogenetic Map3F1UniSTS
Is Marker For: Genes:   Higd1a   Gm9790  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAATGTCAACCAACACAGACC
Reverse Primer CGGTGTCTCCTTAGCTTTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2295439Gm9790predicted gene 979038591570885916169Mouse
1557641Higd1aHIG1 domain family, member 1A9121848557121857796Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884436Zlq3_mzygomatic length QTL 3, 10 week (mouse)33200000142700000Mouse
4142399Aec1_mautoimmune exocrinopathy 1 (mouse)Not determined7521114102782718Mouse
26884427Cvht4_mcranial vault height 4, 10 week (mouse)316000000109800000Mouse
13207570Tcq12_mtotal cholesterol QTL 12 (mouse)316450000130370000Mouse
26884422Cvht7_mcranial vault height 7, 16 week (mouse)328900000119100000Mouse
1302056Orgwq4_morgan weight QTL 4 (mouse)Not determined330013439147599053Mouse
1301705Sles3_msystemic lupus erythmatosus suppressor 3 (mouse)Not determined337120713143647422Mouse
13208566Bmiq5_mbody mass index QTL 5 (mouse)341000000116000000Mouse
26884380Skwq1_mskull length QTL 1, 5 week (mouse)344000000101700000Mouse
26884378Skwq6_mskull length QTL 6, 10 week (mouse)352000000102400000Mouse
26884382Bzwq1_mbi-zygomatic width QTL 1, 5 week (mouse)352300000137500000Mouse
1301917Tshp4_mtooth shape 4 (mouse)Not determined35271817686718412Mouse
1357585Manln3_mmandible length 3 (mouse)Not determined35271817686718412Mouse
1300593Skull4_mskull morphology 4 (mouse)Not determined35271817686718412Mouse
13464139Nhdlq17_mnon-HDL QTL 17 (mouse)35301585087015850Mouse
11039519Ltpr3_mLeishmania tropica response 3 (mouse)356796681100556821Mouse
12880419V125Dq4_mvitamin D active form serum level QTL 4 (mouse)35900000093000000Mouse
4141294Bmd24_mbone mineral density 24 (mouse)Not determined36183275495832934Mouse
1301971Cia5_mcollagen induced arthritis QTL 5 (mouse)Not determined366139351100139488Mouse
25314313Syncl1_msynaptonemal complex length 1 (mouse)368000000128600000Mouse
11251721Ewc3_methanol withdrawal and consumption 3 (mouse)369661247103661247Mouse
1301791Char4_mP. chabaudi malaria resistance QTL 4 (mouse)Not determined369718176100747974Mouse
1301422Sle11_msystematic lupus erythematosus susceptibility 11 (mouse)Not determined370301597104301735Mouse
1300982Lmr11_mleishmaniasis resistance 11 (mouse)Not determined372232660106232787Mouse
11049572Lmr11c_mleishmaniasis resistance 11c (mouse)372232660106232787Mouse
1300595Tmevd2_mTheiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 2 (mouse)Not determined375555995109556242Mouse
1301392Eae3_msusceptibility to experimental allergic encephalomyelitis 3 (mouse)Not determined379641414113641521Mouse
1301947Pcfm3_mperiosteal circumference and femur length 3 (mouse)Not determined381177336115177481Mouse
1301904Iba2_minduction of brown adipocytes 2 (mouse)Not determined382239727116239868Mouse
11039507Ltpr3g_mLeishmania tropica response 3g (mouse)383556675117556821Mouse
11039508Ltpr3f_mLeishmania tropica response 3f (mouse)383556675117556821Mouse
11039509Ltpr3e_mLeishmania tropica response 3e (mouse)383556675117556821Mouse
11039510Ltpr3d_mLeishmania tropica response 3d (mouse)383556675117556821Mouse
11039511Ltpr3c_mLeishmania tropica response 3c (mouse)383556675117556821Mouse
11039512Ltpr3b_mLeishmania tropica response 3b (mouse)383556675117556821Mouse
11041900Lmr11a_mleishmaniasis resistance 11a (mouse)383556675117556821Mouse
1301272Cfsw1_mcystic fibrosis survival to weaning 1 (mouse)Not determined383975596117975728Mouse
4142099Cq3_mcholesterol QTL 3 (mouse)Not determined384981602118981751Mouse
14746984Manh54_mmandible shape 54 (mouse)385381836119381836Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100042265 UniSTS
  56295 UniSTS
UniSTS 164430 UniSTS