AU024121 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU024121

Symbol: AU024121
Also known as: 364178; 
RGD ID: 4957532
Expected Size: 86 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38622,734,383 - 22,734,468UniSTSGRCm38
GRCm38683,080,563 - 83,080,727UniSTSGRCm38
MGSCv37622,684,383 - 22,684,468UniSTSGRCm37
MGSCv37683,030,557 - 83,030,721UniSTSGRCm37
Celera685,063,135 - 85,063,299UniSTS
Celera622,781,756 - 22,781,841UniSTS
Cytogenetic Map6C3UniSTS
Cytogenetic Map6A3.1UniSTS
cM Map635.0UniSTS
Whitehead/MRC_RH6850.27UniSTS
Is Marker For: Genes:   Pcgf1   Gm8930  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGAAGCAAAGGAGATGGCT
Reverse Primer TTGACAATGAGGTTCTCCCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2295285Gm8930predicted gene 893062273372922734587Mouse
5142691Gm18861predicted gene, 1886162275940022761586Mouse
735761Ptprz1protein tyrosine phosphatase, receptor type Z, polypeptide 162287531523052916Mouse
9604302Gm30493predicted gene, 3049362297316822985697Mouse
12796046Gm46954predicted gene, 4695462298819722991626Mouse
1321930Aassaminoadipate-semialdehyde synthase62307217323132986Mouse
1614499Gm8945predicted gene 894562315592923156700Mouse
1617118Gm5989predicted pseudogene 598962315798923160061Mouse
1614493Gm8950predicted gene 895062316336823164091Mouse
1617188Gm5301predicted pseudogene 530162316517323167422Mouse
16079884930554P06RikRIKEN cDNA 4930554P06 gene62318048123181515Mouse
5143637Gm17933predicted gene, 1793362323483323236479Mouse
1558609Fezf1Fez family zinc finger 162324504423250936Mouse
1612393C130093G08RikRIKEN cDNA C130093G08 gene62324901123254484Mouse
1557036Cadps2Ca2+-dependent activator protein for secretion 262326277323841175Mouse
10021915Gm38775predicted gene, 3877562357177523583005Mouse
1619660Rnf133ring finger protein 13362364886923650305Mouse
1615071Rnf148ring finger protein 14862365389523655136Mouse
5142584Gm18966predicted gene, 1896662373649523738126Mouse
1557525Tas2r118taste receptor, type 2, member 11862396916123970060Mouse
62212Slc13a1solute carrier family 13 (sodium/sulfate symporters), member 162408828324168119Mouse
9623381Gm20706predicted gene 2070662413831724141720Mouse
2309373Gm3136predicted gene 313662434325224344590Mouse
1622116IqubIQ motif and ubiquitin domain containing62444486524515067Mouse
731254Ndufa5NADH:ubiquinone oxidoreductase subunit A562451866224527690Mouse
1616681Asb15ankyrin repeat and SOCS box-containing 1562452814424573164Mouse
1557393Lmod2leiomodin 2 (cardiac)62459777124605414Mouse
1553011WaslWASP like actin nucleation promoting factor62461381024664995Mouse
1557495Hyal6hyaluronoglucosaminidase 662473324524745452Mouse
1553131Hyal4hyaluronoglucosaminidase 462474836724766519Mouse
10040359Gm38776predicted gene, 3877662476710824775246Mouse
1551203Spam1sperm adhesion molecule 162479118824801048Mouse
5143230Gm18327predicted gene, 1832762483729424838418Mouse
1557917Hyal5hyaluronoglucosaminidase 562485793724891959Mouse
15001437Gm22267predicted gene, 2226762489467024894800Mouse
1623710Tmem229atransmembrane protein 229A62495114124956125Mouse
10039661Gm38777predicted gene, 3877762503314125057466Mouse
2295772Gm5302predicted gene 530262504646425047317Mouse
15002246Gm24443predicted gene, 2444362507877225078903Mouse
9674105Gm30658predicted gene, 3065862512698925183991Mouse
14996753Gm22529predicted gene, 2252962519993125200051Mouse
735263Gpr37G protein-coupled receptor 3762566852325689980Mouse
1557758Pot1aprotection of telomeres 1A62574394025809277Mouse
10038827Gm38449predicted gene, 3844962575821725758781Mouse
7177941Gm20756predicted gene, 2075662593142625977227Mouse
1621076Gm6719predicted gene 671962597661125977146Mouse
15001034Gm24691predicted gene, 2469162646029126460430Mouse
9611175Gm30779predicted gene, 3077962673977726766895Mouse
10004512Gm38778predicted gene, 3877862720501927218476Mouse
731666Grm8glutamate receptor, metabotropic 862727512128135146Mouse
14999807Gm26310predicted gene, 2631062766808727668203Mouse
1625882Mir592microRNA 59262793665527936750Mouse
15021292Gm52896predicted gene, 5289662809891128116856Mouse
1620285Zfp800zinc finger protein 80062821054828398033Mouse
16174656530409C15RikRIKEN cDNA 6530409C15 gene62821549928234935Mouse
2295771Gm5303predicted gene 530362836170628363168Mouse
1557700Gcc1golgi coiled coil 162841660328421724Mouse
1552329Arf5ADP-ribosylation factor 562842360428426602Mouse
1550470Fscn3fascin actin-bundling protein 362842787028438622Mouse
733722Pax4paired box 462844233428449340Mouse
39128448LOC108251800Pax4 5' regulatory region62844926828451808Mouse
733232Snd1staphylococcal nuclease and tudor domain containing 162848033728935162Mouse
1615740Lrrc4leucine rich repeat containing 462882812628831747Mouse
10003399Gm38779predicted gene, 3877962895738828966041Mouse
10037563Gm40357predicted gene, 4035762896488028966412Mouse
1607651Mir129-1microRNA 129-162902261929022691Mouse
9627803Lncleplong noncoding RNA upstream of leptin62903095429039527Mouse
39130404LOC108150746Lep proximal promoter region62905946029060270Mouse
69124Lepleptin62906022129073876Mouse
15000839Gm25589predicted gene, 2558962911344129113606Mouse
1322737Rbm28RNA binding motif protein 2862912357329164724Mouse
1614237Prrt4proline-rich transmembrane protein 462916923029179584Mouse
1551714Impdh1inosine monophosphate dehydrogenase 162920043629216364Mouse
15000577Gm26021predicted gene, 2602162923443429234564Mouse
10017259Gm40358predicted gene, 4035862925029129264959Mouse
1619151Hilpdahypoxia inducible lipid droplet associated62927248829275449Mouse
1622905Fam71f2family with sequence similarity 71, member F262927752829290684Mouse
1623697Fam71f1family with sequence similarity 71, member F162931346929336022Mouse
733018Calucalumenin62934810629376675Mouse
732047Opn1swopsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)62937667129380513Mouse
39128553Serblue cone (S) opsin upstream regulatory region62938041329387084Mouse
7488559n-TPagg6nuclear encoded tRNA proline 6 (anticodon AGG)62938882429388895Mouse
1614165Ccdc136coiled-coil domain containing 13662939657429426995Mouse
1558082Flncfilamin C, gamma62943315329461889Mouse
1332038Atp6v1fATPase, H+ transporting, lysosomal V1 subunit F62946778329470509Mouse
1623355Atp6v1fnbAtp6v1f neighbor62947143729473429Mouse
1557784Kcpkielin/chordin-like protein62947316229508003Mouse
10002029Gm26627predicted gene, 2662762950717229524704Mouse
1321355Irf5interferon regulatory factor 562952613029541869Mouse
1318998Tnpo3transportin 362954082729609858Mouse
9603862Gm30896predicted gene, 3089662967596129677529Mouse
10037476Gm38780predicted gene, 3878062968690129688724Mouse
1558464Tspan33tetraspanin 3362969421429718558Mouse
735969Smosmoothened, frizzled class receptor62973549729761366Mouse
9645747Gm13717predicted gene 1371762975017229751140Mouse
1558124Ahcyl2S-adenosylhomocysteine hydrolase-like 262976837929912310Mouse
1617234Strip2striatin interacting protein 262991697629959681Mouse
15023098Gm52897predicted gene, 5289762995052429968808Mouse
4860422Gm13724predicted gene 1372462996095029961762Mouse
15554266Gm24536predicted gene, 2453662996355529963661Mouse
9651023Gm31103predicted gene, 3110362996445629968561Mouse
1615809Smkr-pssmal lysine rich protein 1, pseudogene62998532929993531Mouse
16183021700080G18RikRIKEN cDNA 1700080G18 gene63004740030049144Mouse
1312138Nrf1nuclear respiratory factor 163004798530153458Mouse
9592320Gm31162predicted gene, 3116263006045230062307Mouse
7245468Mirc35hgmicroRNA cluster 35, host gene63015864030174125Mouse
1608314Mir182microRNA 18263016591830165992Mouse
1608170Mir96microRNA 9663016944630169551Mouse
1608313Mir183microRNA 18363016966830169737Mouse
3600926BB283400expressed sequence BB28340063017662330178046Mouse
9676571Gm31221predicted gene, 3122163017815530181830Mouse
1320679Ube2hubiquitin-conjugating enzyme E2H63021128930304539Mouse
16102801700095J07RikRIKEN cDNA 1700095J07 gene63030461530331805Mouse
1557238Zc3hc1zinc finger, C3HC type 163036638430391049Mouse
1320321Klhdc10kelch domain containing 1063040151730455179Mouse
16119101700012C14RikRIKEN cDNA 1700012C14 gene63046098530463313Mouse
1320159Tmem209transmembrane protein 20963048102230509787Mouse
1622234Ssmem1serine-rich single-pass membrane protein 163050979130520254Mouse
1614164Cpa2carboxypeptidase A2, pancreatic63054164230564476Mouse
12797370Gm46955predicted gene, 4695563054763730550785Mouse
1622267Cpa4carboxypeptidase A463056836930592418Mouse
9999606Gm13781predicted gene 1378163057219930577790Mouse
9608216Gm31453predicted gene, 3145363059413530610993Mouse
1552661Cpa5carboxypeptidase A563061101030631745Mouse
733564Cpa1carboxypeptidase A1, pancreatic63063921830645361Mouse
1558165Cep41centrosomal protein 4163065345730710517Mouse
9593226Gm13782predicted gene 1378263066755130684319Mouse
1621604Mestmesoderm specific transcript63073350630748466Mouse
1607592Mir335microRNA 33563074129930741396Mouse
1556929Copg2coatomer protein complex, subunit gamma 263074755430896815Mouse
10003499Gm38781predicted gene, 3878163088643430893789Mouse
1314384Tsga13testis specific gene A1363089698130921570Mouse
16080474930412F09RikRIKEN cDNA 4930412F09 gene63090356230913893Mouse
1617115Klf14Kruppel-like factor 1463095602130958990Mouse
10017271Gm40359predicted gene, 4035963101006531014943Mouse
1607664Mir29amicroRNA 29a63106266031062747Mouse
1607663Mir29b-1microRNA 29b-163106302331063093Mouse
8181341Lncpintlong non-protein coding RNA, Trp53 induced transcript63109356331218474Mouse
10025954Gm38784predicted gene, 3878463112680631130537Mouse
2294094Gm13835predicted gene 1383563114186531142726Mouse
10037150Gm38783predicted gene, 3878363119469231207553Mouse
16174882210408F21RikRIKEN cDNA 2210408F21 gene63122035131337395Mouse
10034610Gm38782predicted gene, 3878263124057831243408Mouse
9627076Gm14532predicted gene 1453263135632631373690Mouse
5145126Mkln1osmuskelin 1, intracellular mediator containing kelch motifs, opposite strand63136688531398773Mouse
734392Mkln1muskelin 1, intracellular mediator containing kelch motifs63139882831516809Mouse
736844Podxlpodocalyxin-like63151949331563937Mouse
1614657Gm6117predicted gene 611763157496731576605Mouse
9628588Gm31486predicted gene, 3148663160514231635773Mouse
10001829Gm13846predicted gene 1384663165101031743088Mouse
11081777Gm13848predicted gene 1384863166222031666131Mouse
9657291Gm13847predicted gene 1384763166616031680697Mouse
9636528Gm31660predicted gene, 3166063171815131720365Mouse
10006594Gm38454predicted gene, 3845463173121531743088Mouse
39131149LOC115490344uncharacterized LOC11549034463179282731799290Mouse
9636750Gm31894predicted gene, 3189463201799832040930Mouse
16167011700012A03RikRIKEN cDNA 1700012A03 gene63205028832059062Mouse
10001257Gm13850predicted gene 1385063211210232117525Mouse
1317637Plxna4plexin A463214454332588192Mouse
1613263Plxna4os1plexin A4, opposite strand 163251114132515576Mouse
12796347Gm46956predicted gene, 4695663259825432635123Mouse
9633391Gm32007predicted gene, 3200763263599632657223Mouse
1321164Chchd3coiled-coil-helix-coiled-coil-helix domain containing 363279220733060273Mouse
10007209Gm40360predicted gene, 4036063281854132829813Mouse
14996661Gm22321predicted gene, 2232163308864633088749Mouse
1617187Gm1401predicted gene 140163324726833249073Mouse
733006Exoc4exocyst complex component 463324909033973979Mouse
5147166Gm13854predicted gene 1385463337591033377420Mouse
10031975Gm38785predicted gene, 3878563344286233474839Mouse
9677626Gm13853predicted gene 1385363398178333992417Mouse
10032767Gm38786predicted gene, 3878663402241434029724Mouse
1317880Lrgukleucine-rich repeats and guanylate kinase domain containing63402924534134034Mouse
5129081Gm13856predicted gene 1385663415185834163992Mouse
1615909Slc35b4solute carrier family 35, member B463415587234177054Mouse
10000568Gm13855predicted gene 1385563417704834179377Mouse
9633231Gm32533predicted gene, 3253363419717834227076Mouse
10001534Gm14546predicted gene 1454663428833534324249Mouse
736610Akr1b3aldo-keto reductase family 1, member B3 (aldose reductase)63430393034317489Mouse
1550101Akr1b8aldo-keto reductase family 1, member B863435414634368461Mouse
2312227Gm13858predicted gene 1385863436245034380442Mouse
5147167Gm13859predicted gene 1385963437369134374738Mouse
1317960Akr1b10aldo-keto reductase family 1, member B10 (aldose reductase)63438424734396949Mouse
730835Akr1b7aldo-keto reductase family 1, member B763441236234423137Mouse
9662703Gm13857predicted gene 1385763444253334445436Mouse
1551134Bpgm2,3-bisphosphoglycerate mutase63447635634505136Mouse
15022635Gm52898predicted gene, 5289863451033434511785Mouse
9650404Gm32942predicted gene, 3294263453406534536907Mouse
730857Cald1caldesmon 163459849534775469Mouse
2293921Gm13861predicted gene 1386163465135434653915Mouse
10028046Gm38787predicted gene, 3878763471229534732802Mouse
1558047Agbl3ATP/GTP binding protein-like 363478043234860939Mouse
5147248Gm13864predicted gene 1386463478666334787505Mouse
12794174Gm46957predicted gene, 4695763484133534849156Mouse
1617537Tmem140transmembrane protein 14063486314634874946Mouse
1620718Cyrencell cycle regulator of NHEJ63487177134878065Mouse
1315464Wdr91WD repeat domain 9163488042634910831Mouse
1624070Stra8stimulated by retinoic acid gene 863492016334939344Mouse
1618938Slc23a4solute carrier family 23 member 463494528634988495Mouse
1321154Cnot4CCR4-NOT transcription complex, subunit 463502206535133754Mouse
9626972Gm33046predicted gene, 3304663513353135152340Mouse
1620780Nup205nucleoporin 20563517761635247599Mouse
14999515Gm23435predicted gene, 2343563524360235243750Mouse
22930361810058I24RikRIKEN cDNA 1810058I24 gene63525271035261639Mouse
1558400Slc13a4solute carrier family 13 (sodium/sulfate symporters), member 463526795335308126Mouse
1317537Fam180afamily with sequence similarity 180, member A63531274335326141Mouse
10029348Gm38788predicted gene, 3878863531315435322106Mouse
16108301700065J11RikRIKEN cDNA 1700065J11 gene63533084635336831Mouse
10022510Gm38789predicted gene, 3878963541280435419014Mouse
732852Mtpnmyotrophin63550882435539888Mouse
10016314Gm38790predicted gene, 3879063596587935999695Mouse
15001628Gm23273predicted gene, 2327363597533035975464Mouse
9660841Gm33120predicted gene, 3312063619653136270098Mouse
39129052LOC115490482small nucleolar RNA SNORA4863623857336238715Mouse
22930589330158H04RikRIKEN cDNA 9330158H04 gene63633313836388234Mouse
1552578Chrm2cholinergic receptor, muscarinic 2, cardiac63638799136528638Mouse
1625871Mir490microRNA 49063642174236421825Mouse
2310900Gm2189predicted gene 218963663981136640266Mouse
11190Ptnpleiotrophin63671492436810179Mouse
15022666Gm52856predicted gene, 5285663671576236761409Mouse
1621241Dgkidiacylglycerol kinase, iota63683738137300955Mouse
15023258Gm52857predicted gene, 5285763690353336915387Mouse
16102731700111E14RikRIKEN cDNA 1700111E14 gene63693705436985777Mouse
1617786Gm7452predicted pseudogene 745263695665436960430Mouse
1550380Creb3l2cAMP responsive element binding protein 3-like 263732725537442276Mouse
9598499Gm33275predicted gene, 3327563741805837419452Mouse
9677672Gm33318predicted gene, 3331863744251037447405Mouse
9664012Gm33429predicted gene, 3342963752645637531403Mouse
733770Akr1d1aldo-keto reductase family 1, member D163752997837574921Mouse
2310863Gm7463predicted gene 746363754141337541988Mouse
1619062Ybx1-ps2Y box protein 1, pseudogene 263768563737687305Mouse
10015117Gm38791predicted gene, 3879163771465537734381Mouse
2290527Atp6v0c-ps2ATPase, H+ transporting, lysosomal V0 subunit C, pseudogene 263780597537807107Mouse
2310770Gm7492predicted gene 749263786583837866564Mouse
1615938Trim24tripartite motif-containing 2463787081137968445Mouse
1557536SvoplSV2 related protein homolog (rat)-like63798373938047009Mouse
5143157Gm18401predicted gene, 1840163799466537995316Mouse
9662727Gm33494predicted gene, 3349463803265938035496Mouse
1312857Atp6v0a4ATPase, H+ transporting, lysosomal V0 subunit A463804848338124586Mouse
39128844LOC115490494small nucleolar RNA U1363805797338058076Mouse
1617458Tmem213transmembrane protein 21363810935338115806Mouse
15002779Gm23231predicted gene, 2323163811838338118486Mouse
1314795D630045J12RikRIKEN cDNA D630045J12 gene63812317438254139Mouse
15018077Gm52858predicted gene, 5285863814005638146161Mouse
9666801Gm33553predicted gene, 3355363821129138213773Mouse
2295746Gm7504predicted gene 750463828444538285009Mouse
1319464Zc3hav1lzinc finger CCCH-type, antiviral 1-like63828739438299259Mouse
736107Zc3hav1zinc finger CCCH type, antiviral 163830528638355352Mouse
1620885Rpl30-ps1ribosomal protein L30, pseudogene 163837673738377193Mouse
1621994Ttc26tetratricopeptide repeat domain 2663838146438427647Mouse
10039833Gm38792predicted gene, 3879263842654738429744Mouse
1558459Ubn2ubinuclein 263843392538512763Mouse
10002165Mir7670microRNA 767063850732538507393Mouse
7488616n-TRcct1nuclear encoded tRNA arginine 1 (anticodon CCT)63853393138534003Mouse
1321794Fmc1formation of mitochondrial complex V assembly factor 163853486138539449Mouse
2311819Gm15697predicted gene 1569763854210338546172Mouse
1551050Luc7l2LUC7-like 2 (S. cerevisiae)63855133438609953Mouse
1623151Klrg2killer cell lectin-like receptor subfamily G, member 263861632938638815Mouse
1609383Clec2lC-type lectin domain family 2, member L63866306938680865Mouse
39129144LOC108167305Clec2l Hedgehog-responsive enhancer63866400138665183Mouse
1319650Hipk2homeodomain interacting protein kinase 263868751238876331Mouse
10035921Gm38496predicted gene, 3849663869974438741900Mouse
16089374930502C15RikRIKEN cDNA 4930502C15 gene63873751638792619Mouse
39129076Hipk2r16Hipk2R16 erythroid cis-regulatory module63877128238771451Mouse
11394Tbxas1thromboxane A synthase 1, platelet63886415939084590Mouse
12797161Gm46988predicted gene, 4698863887611138885050Mouse
9637072Gm33767predicted gene, 3376763894476738950110Mouse
10028814Gm38793predicted gene, 3879363895826038986574Mouse
15017288Gm52859predicted gene, 5285963896173638965942Mouse
10020958Gm38688predicted gene, 3868863898682439005703Mouse
15002907Gm23010predicted gene, 2301063901366639013791Mouse
10017980Gm38489predicted gene, 3848963901919839043829Mouse
12794065Gm46989predicted gene, 4698963904416639054825Mouse
16158631700025N23RikRIKEN cDNA 1700025N23 gene63906387939067586Mouse
1551043Parp12poly (ADP-ribose) polymerase family, member 1263908641239118349Mouse
56854164930599N23RikRIKEN cDNA 4930599N23 gene63911847339148312Mouse
1619690Kdm7alysine (K)-specific demethylase 7A63913662039206773Mouse
10016636Gm38794predicted gene, 3879463922756539245345Mouse
9677696Gm34147predicted gene, 3414763924615339265611Mouse
32718008Gm53067predicted gene, 5306763926565039299475Mouse
9672037Gm26008predicted gene, 2600863926584439265942Mouse
1321199Slc37a3solute carrier family 37 (glycerol-3-phosphate transporter), member 363933477039377725Mouse
1558002Rab19RAB19, member RAS oncogene family63938070939390666Mouse
1551460Mkrn1makorin, ring finger protein, 163939780439423299Mouse
5141031Gm19565predicted gene, 1956563940571839420037Mouse
1623515Gm10244predicted gene 1024463942037839421294Mouse
14999420Gm25402predicted gene, 2540263942228939422419Mouse
1620636Dennd2aDENN/MADD domain containing 2A63946237439558145Mouse
15019876Gm52860predicted gene, 5286063947044039508248Mouse
110837688030453O22RikRIKEN cDNA 8030453O22 gene63952754139544489Mouse
39128414LOC109280107VISTA enhancer mm132163954175539546349Mouse
1322313Adck2aarF domain containing kinase 263957384439588769Mouse
1317725Ndufb2NADH:ubiquinone oxidoreductase subunit B263959256539599843Mouse
735646BrafBraf transforming gene63960323139725658Mouse
9658638Gm34389predicted gene, 3438963961579339643023Mouse
1624092Fth-ps2ferritin heavy chain, pseudogene 263965329939653788Mouse
1319436Mrps33mitochondrial ribosomal protein S3363980180439810936Mouse
2310675Gm7554predicted gene 755463982815239828809Mouse
2295652Gm7556predicted gene 755663984302239844485Mouse
1614722Tmem178btransmembrane protein 178B63987123040255150Mouse
1615867Agkacylglycerol kinase64032507640397570Mouse
1618937Dennd11DENN domain containing 1164040137540436135Mouse
1617198Wee2WEE1 homolog 2 (S. pombe)64043524640466815Mouse
736465Ssbp1single-stranded DNA binding protein 164047141440481823Mouse
1614664Tas2r137taste receptor, type 2, member 13764049123840492239Mouse
1624021Tas2r108taste receptor, type 2, member 10864049359240494485Mouse
1323481Prss37protease, serine 3764051482040519535Mouse
1616483Olfr461olfactory receptor 46164054403640544977Mouse
1552971Olfr460olfactory receptor 46064056915240572504Mouse
1620879Clec5aC-type lectin domain family 5, member a64057489840585805Mouse
1558560Tas2r138taste receptor, type 2, member 13864061231540613310Mouse
1318098Mgammaltase-glucoamylase64062883140769123Mouse
1618605Mgam2-psmaltase-glucoamylase 2, pseudogene64079782440855590Mouse
1558176Moxd2monooxygenase, DBH-like 264087879440887494Mouse
11268634Trbv1T cell receptor beta, variable 164089129640891885Mouse
11402TcrbT cell receptor beta chain64089129641558371Mouse
1623780Prss58protease, serine 5864089526240900387Mouse
15520381700074P13RikRIKEN cDNA 1700074P13 gene64092043740941041Mouse
2309039Gm4744predicted gene 474464094846240954352Mouse
15526421810009J06RikRIKEN cDNA 1810009J06 gene64096477240968427Mouse
2299616Gm2663predicted gene 266364099582240999479Mouse
15499972210010C04RikRIKEN cDNA 2210010C04 gene64103026841035509Mouse
11288921Trbv2T cell receptor beta, variable 264104755641047995Mouse
11258399Trbv3T cell receptor beta, variable 364104839441048824Mouse
11273085Trbv4T cell receptor beta, variable 1064105944341059886Mouse
11331589Trbv5T cell receptor beta, variable 564106235941062803Mouse
5135613Trbv6T cell receptor beta variable 664106687141067154Mouse
5135614Trbv7T cell receptor beta variable 764108025341080654Mouse
5135609Trbv8T cell receptor beta variable 864108466941085107Mouse
5135608Trbv9T cell receptor beta variable 964108799141088288Mouse
5144957Trbv10T cell receptor beta variable 1064109193541092228Mouse
5135602Trbv11T cell receptor beta variable 1164110680541107303Mouse
11258666Trbv12-1T cell receptor beta, variable 12-164111356741114067Mouse
11318488Trbv13-1T cell receptor beta, variable 13-164111603641116468Mouse
11308907Trbv12-2T cell receptor beta, variable 12-264111886441119364Mouse
11291488Trbv13-2T cell receptor beta, variable 13-264112139641121832Mouse
4892552Trbv12-3T cell receptor beta, variable 12-364112759241128076Mouse
11332846Trbv13-3T cell receptor beta, variable 13-364113014741130585Mouse
11313297Trbv14T cell receptor beta, variable 1464113516741135616Mouse
11282365Trbv15T cell receptor beta, variable 1564114121141141658Mouse
11256833Trbv16T cell receptor beta, variable 1664115179141152230Mouse
11288625Trbv17T cell receptor beta, variable 1764116309241163556Mouse
5135606Trbv18T cell receptor beta variable 1864117513741175608Mouse
11327892Trbv19T cell receptor beta, variable 1964117858941179048Mouse
11296586Trbv20T cell receptor beta, variable 2064118827341188977Mouse
11318726Trbv21T cell receptor beta, variable 2164120258741203044Mouse
5135605Trbv22T cell receptor beta variable 2264121207541212534Mouse
11335209Trbv23T cell receptor beta, variable V2364121607341216526Mouse
11292458Trbv24T cell receptor beta, variable 2464121809141218557Mouse
5135603Trbv25T cell receptor beta variable 2564122167441222210Mouse
11322037Trbv26T cell receptor beta, variable 2664122752541227913Mouse
2299587Gm2719predicted pseudogene 271964125322841254327Mouse
5135601Trbv27T cell receptor beta variable 2764125812141258579Mouse
5135604Trbv28T cell receptor beta variable 2864126669741267150Mouse
5013942Trbv29T cell receptor beta, variable 2964127140341271881Mouse
11332752Trbv30T cell receptor beta, variable 3064128137641281990Mouse
1614404Try4trypsin 464130227241305533Mouse
5142585Gm18964predicted gene, 1896464130620341306747Mouse
2315721Try5trypsin 564131123241314710Mouse
1615456Try10trypsin 1064135410541357944Mouse
1614405Prss3protease, serine 364137375941377613Mouse
1615455Gm5771predicted gene 577164139235641397256Mouse
1620410Gm5409predicted pseudogene 540964141690741419637Mouse
2295077Gm10334predicted gene 1033464144221441446097Mouse
735825Prss1protease, serine 1 (trypsin 1)64145893041463786Mouse
9643532Gm29813predicted gene, 2981364149338141495152Mouse
737201Prss2protease, serine 264152177641525079Mouse
11315372Trbd1T cell receptor beta, D region 164153320141533212Mouse
11286741Trbj1-1T cell receptor beta joining 1-164153386441533911Mouse
11283978Trbj1-2T cell receptor beta joining 1-264153400141534048Mouse
11324263Trbj1-3T cell receptor beta joining 1-364153432341534372Mouse
11292793Trbj1-4T cell receptor beta joining 1-464153481141534861Mouse
11253273Trbj1-5T cell receptor beta joining 1-564153508441535133Mouse
11305807Trbj1-6T cell receptor beta joining 1-664153555441535606Mouse
11306809Trbj1-7T cell receptor beta joining 1-764153564241535687Mouse
11309931Trbc1T cell receptor beta, constant region 164153821941539665Mouse
11298959Trbd2T cell receptor beta, D region 264154216341542176Mouse
11280561Trbj2-1T cell receptor beta joining 2-164154275441542803Mouse
11303398Trbj2-2T cell receptor beta joining 2-264154295741543007Mouse
11264567Trbj2-3T cell receptor beta joining 2-364154322341543271Mouse
11279984Trbj2-4T cell receptor beta joining 2-464154336241543410Mouse
11306630Trbj2-5T cell receptor beta joining 2-564154345341543501Mouse
5135591Trbj2-6T cell receptor beta joining 2-664154359841543645Mouse
11315186Trbj2-7T cell receptor beta joining 2-764154381041543856Mouse
11266724Trbc2T cell receptor beta, constant 264154673041548181Mouse
11313133Trbv31T cell receptor beta, variable 3164155769341558371Mouse
10010945Gm38582predicted gene, 3858264155848841603450Mouse
15000796Gm27549predicted gene, 2754964160224441602305Mouse
1314624Ephb6Eph receptor B664160383441620509Mouse
735419Trpv6transient receptor potential cation channel, subfamily V, member 664162061941636405Mouse
10017887Gm38795predicted gene, 3879564162177441625962Mouse
9640302Gm34642predicted gene, 3464264164173041658017Mouse
1551251Trpv5transient receptor potential cation channel, subfamily V, member 564165166141681224Mouse
1614279Llcfc1LLLL and CFNLAS motif containing 164168438741685717Mouse
1316930KelKell blood group64168632941704334Mouse
10012990Gm38796predicted gene, 3879664170618741710140Mouse
1614847Olfr459olfactory receptor 45964177135341772297Mouse
737423Pipprolactin induced protein64184754941852065Mouse
735619Sval2seminal vesicle antigen-like 264186030741864413Mouse
737347Sval1seminal vesicle antigen-like 164195162841956098Mouse
1622780Sval3seminal vesicle antigen-like 364196814041973090Mouse
1623278Svaseminal vesicle antigen64203839442042851Mouse
9623759Gm34701predicted gene, 3470164210579042114521Mouse
1617210Tas2r139taste receptor, type 2, member 13964214093642141895Mouse
1558233Tas2r144taste receptor, type 2, member 14464221532842216287Mouse
1332271Gstk1glutathione S-transferase kappa 164224593542250441Mouse
1623859Tmem139transmembrane protein 13964226193242264555Mouse
731460Casp2caspase 264226490242282508Mouse
737113Clcn1chloride channel, voltage-sensitive 164228485142315764Mouse
10029917Gm38797predicted gene, 3879764230779242310932Mouse
1618282Fam131bfamily with sequence similarity 131, member B64231530542324640Mouse
15000603Gm24611predicted gene, 2461164233767742337782Mouse
1550839Zyxzyxin64234951142360213Mouse
1312266Epha1Eph receptor A164235848742373314Mouse
16108392010310C07RikRIKEN cDNA 2010310C07 gene64237067142380558Mouse
1557265Tas2r143taste receptor, type 2, member 14364240023842401119Mouse
1622787Tas2r135taste receptor, type 2, member 13564240552942406494Mouse
1552906Tas2r126taste receptor, type 2, member 12664243453542435461Mouse
9663601Gm34818predicted gene, 3481864244563242445912Mouse
1551395Olfr458olfactory receptor 45864246007642461017Mouse
1552614Olfr457olfactory receptor 45764247123542472176Mouse
1620504Olfr456olfactory receptor 45664248616342487214Mouse
9598561Gm34752predicted gene, 3475264250963042521467Mouse
2302838Gm4877predicted gene 487764251947442520332Mouse
1617117Olfr455olfactory receptor 45564253806742539020Mouse
10003514Gm38798predicted gene, 3879864257827942581727Mouse
1623651Tcaf3TRPM8 channel-associated factor 364258721342597372Mouse
1312466Tcaf2TRPM8 channel-associated factor 264262304342645041Mouse
1617453Tcaf1TRPM8 channel-associated factor 164266799942710131Mouse
2302725Olfr454-ps1olfactory receptor 454, pseudogene 164272133642722236Mouse
14998847Gm44030predicted gene, 4403064272559142726075Mouse
1553410Olfr453olfactory receptor 45364274403942744992Mouse
1552728Olfr38olfactory receptor 3864276205442763007Mouse
15002530Gm22363predicted gene, 2236364277557342775680Mouse
1550344Olfr452olfactory receptor 45264279004142790994Mouse
15019767Gm51439predicted gene, 5143964279716642797289Mouse
1618917Olfr451-ps1olfactory receptor 451, pseudogene 164280074342801675Mouse
1552335Olfr450olfactory receptor 45064281747342818405Mouse
1550172Olfr449olfactory receptor 44964283441642838882Mouse
39129994LOC114574117olfactory receptor enhancer Sfaktiria64286964142870542Mouse
1553880Olfr448olfactory receptor 44864289645342897385Mouse
1550998Olfr447olfactory receptor 44764291152542912457Mouse
1617258Olfr446olfactory receptor 44664292723342928159Mouse
2302721Olrf445-ps1olfactory receptor 445, pseudogene 164293407242934941Mouse
1614106Olfr444olfactory receptor 44464295550042956432Mouse
9631312Gm34905predicted gene, 3490564301450243067284Mouse
10011358Gm38799predicted gene, 3879964306745943090458Mouse
1618090Olfr443-ps1olfactory receptor 443, pseudogene 164309443543095346Mouse
2302722Olfr442-ps1olfactory receptor 442, pseudogene 164309911343099700Mouse
1614107Olfr441olfactory receptor 44164311574443116676Mouse
1618089Olfr440-ps1olfactory receptor 440, pseudogene 164312235443123263Mouse
2302723Olfr439-ps1olfactory receptor 439, pseudogene 164313782743138419Mouse
1550616Olfr237olfactory receptor 23764315330743154239Mouse
16130641700024N05RikRIKEN cDNA 1700024N05 gene64316245443174858Mouse
1617257Olfr437olfactory receptor 43764316706043167992Mouse
1553836Olfr13olfactory receptor 1364317398843174920Mouse
39130604LOC115490404uncharacterized LOC11549040464317506243176102Mouse
2302724Olfr436-ps1olfactory receptor 436, pseudogene 164318664843187447Mouse
1551537Olfr435olfactory receptor 43564320164643202587Mouse
1552081Olfr434olfactory receptor 43464321691543217880Mouse
1553349Olfr47olfactory receptor 4764323561043236575Mouse
735724Arhgef5Rho guanine nucleotide exchange factor (GEF) 564326564443289320Mouse
1557267NoboxNOBOX oogenesis homeobox64330367443310072Mouse
1558263Tpk1thiamine pyrophosphokinase64333957643667792Mouse
2299040Gm15550predicted gene 1555064337372943375749Mouse
9674485Gm35113predicted gene, 3511364338036643392531Mouse
10009932Gm38800predicted gene, 3880064341209443420425Mouse
16132769430018G01RikRIKEN cDNA 9430018G01 gene64344242943474318Mouse
12795503Gm46984predicted gene, 4698464367880643679721Mouse
2309270Gm5990predicted gene 599064376656543767315Mouse
9645906Gm35163predicted gene, 3516364383925543852378Mouse
2295192Gm7783predicted gene 778364385608243856923Mouse
15000102Gm22939predicted gene, 2293964388719443887324Mouse
9597360Gm35216predicted gene, 3521664408048844083355Mouse
1316053Cntnap2contactin associated protein-like 264506006147301393Mouse
5143076Gm18483predicted gene, 1848364589447445895029Mouse
14999623Gm25161predicted gene, 2516164648170946481840Mouse
1623285Rbpj-ps3recombination signal binding protein for immunoglobulin kappa J region, pseudogene 364652915146530884Mouse
5143073Gm18484predicted gene, 1848464663725446638302Mouse
9674694Gm35931predicted gene, 3593164677835446778858Mouse
10031644Gm38801predicted gene, 3880164695377046957833Mouse
9616779Gm35875predicted gene, 3587564700657747040804Mouse
3630591Gm6352predicted gene 635264704515647046286Mouse
9624347Gm35798predicted gene, 3579864712000947124958Mouse
9604245Gm35280predicted gene, 3528064719138447257353Mouse
9621034Gm35565predicted gene, 3556564722749847230570Mouse
5142975Gm18584predicted gene, 1858464743212347432820Mouse
1614815A930035D04RikRIKEN cDNA A930035D04 gene64745233447460855Mouse
1317769Cul1cullin 164745373247526144Mouse
1312684Ezh2enhancer of zeste 2 polycomb repressive complex 2 subunit64753027447595270Mouse
1608968F830010H11RikRIKEN cDNA F830010H11 gene64759520947597538Mouse
10024011Gm40371predicted gene, 4037164764460747651320Mouse
10004599Gm40370predicted gene, 4037064765223147656955Mouse
10029784Gm40369predicted gene, 4036964765290147657148Mouse
1622369Rn4.5s4.5S RNA64765492147655094Mouse
10026278Gm40368predicted gene, 4036864765637047660430Mouse
10031352Gm40367predicted gene, 4036764766259247665812Mouse
9631170Gm36504predicted gene, 3650464766503847669121Mouse
10007838Gm40365predicted gene, 4036564766936747675070Mouse
10011839Gm40366predicted gene, 4036664766947547674273Mouse
9642341Gm36327predicted gene, 3632764767558247678797Mouse
10019901Gm40364predicted gene, 4036464767990747682091Mouse
10014590Gm40363predicted gene, 4036364768234447738326Mouse
15020719Gm52861predicted gene, 5286164773883747747801Mouse
15021505Gm52862predicted gene, 5286264775526647757004Mouse
9597543Gm29847predicted gene, 2984764775564947757004Mouse
9629346Gm36761predicted gene, 3676164775903647763515Mouse
9669671Gm36872predicted gene, 3687264776103147762903Mouse
9651342Gm36673predicted gene, 3667364776221047773095Mouse
1612340Rny3RNA, Y3 small cytoplasmic (associated with Ro protein)64778162447781724Mouse
1617186Rpl31-ps7ribosomal protein L31, pseudogene 764778595847786374Mouse
1612341Rny1RNA, Y1 small cytoplasmic, Ro-associated64778807047788180Mouse
1551534Pdia4protein disulfide isomerase associated 464779614147813512Mouse
1625863Mir704microRNA 70464780357647803652Mouse
2307724Rpl35a-ps7ribosomal protein L35A, pseudogene 764781525647815693Mouse
1558319Zfp786zinc finger protein 78664781553647836197Mouse
1557875Zfp398zinc finger protein 39864783563347873542Mouse
1314807Zfp282zinc finger protein 28264787720947908485Mouse
1317264Zfp212Zinc finger protein 21264792056847932639Mouse
9678341Gm30210predicted gene, 3021064792191447926536Mouse
15021019Gm52899predicted gene, 5289964792244247926536Mouse
1623779Zfp783zinc finger protein 78364794317547954549Mouse
1312574Zfp956zinc finger protein 95664795339047965300Mouse
2294199Gm6443predicted gene 644364797699147977896Mouse
7488588n-TCgca57nuclear encoded tRNA cysteine 57 (anticodon GCA)64797899747979068Mouse
1617504Zfp777zinc finger protein 77764801766048050004Mouse
1314697Zfp746zinc finger protein 74664806239148086986Mouse
9675067Gm30435predicted gene, 3043564813047348146077Mouse
11083147Gm16630predicted gene, 1663064813090648395408Mouse
7488836n-TCgca37nuclear encoded tRNA cysteine 37 (anticodon GCA)64813393748134008Mouse
7488512n-TCgca10nuclear encoded tRNA cysteine 10 (anticodon GCA)64813951048139581Mouse
7488706n-TCgca4nuclear encoded tRNA cysteine 4 (anticodon GCA)64814048448140555Mouse
7488889n-TCgca13nuclear encoded tRNA cysteine 13 (anticodon GCA)64814335648143427Mouse
7488488n-TCgca36nuclear encoded tRNA cysteine 36 (anticodon GCA)64814492848144999Mouse
7488536n-TCgca38nuclear encoded tRNA cysteine 38 (anticodon GCA)64815471448154785Mouse
7488589n-TCgca35nuclear encoded tRNA cysteine 35 (anticodon GCA)64815627548156346Mouse
7488736n-TCgca39nuclear encoded tRNA cysteine 39 (anticodon GCA)64816017948160250Mouse
3922559n-TCgca40nuclear encoded tRNA cysteine 40 (anticodon GCA)64816410148164172Mouse
7488778n-TCgca8nuclear encoded tRNA cysteine 8 (anticodon GCA)64818631848186389Mouse
7488843n-TCgca41nuclear encoded tRNA cysteine 41 (anticodon GCA)64819702648197097Mouse
7488629n-TCgca1nuclear encoded tRNA cysteine 1 (anticodon GCA)64820506848205139Mouse
7488840n-TCgca34nuclear encoded tRNA cysteine 34 (anticodon GCA)64820745148207522Mouse
7488873n-TCgca49nuclear encoded tRNA cysteine 49 (anticodon GCA)64820983848209909Mouse
10021051Gm38802predicted gene, 3880264822218248247389Mouse
7488731n-TCgca33nuclear encoded tRNA cysteine 33 (anticodon GCA)64822309448223165Mouse
7488850n-TCgca48nuclear encoded tRNA cysteine 48 (anticodon GCA)64822432948224400Mouse
7488495n-TCgca32nuclear encoded tRNA cysteine 32 (anticodon GCA)64824431648244387Mouse
7488814n-TCgca31nuclear encoded tRNA cysteine 31 (anticodon GCA)64825210348252174Mouse
7488645n-TCgca15nuclear encoded tRNA cysteine 15 (anticodon GCA)64825308048253151Mouse
7488647n-TCgca30nuclear encoded tRNA cysteine 30 (anticodon GCA)64826172248261793Mouse
7488678n-TCgca29nuclear encoded tRNA cysteine 29 (anticodon GCA)64826845848268529Mouse
7488537n-TCgca42nuclear encoded tRNA cysteine 42 (anticodon GCA)64827192648271997Mouse
7488855n-TCgca43nuclear encoded tRNA cysteine 43 (anticodon GCA)64827368048273751Mouse
9616612Gm30362predicted gene, 3036264827524548338162Mouse
7488587n-TCgca3nuclear encoded tRNA cysteine 3 (anticodon GCA)64827879248278863Mouse
7488812n-TCgca28nuclear encoded tRNA cysteine 28 (anticodon GCA)64827977148279842Mouse
7488530n-TCgca12nuclear encoded tRNA cysteine 12 (anticodon GCA)64828887648288947Mouse
14999094Gm22122predicted gene, 2212264828922848289427Mouse
7488725n-TCgca50nuclear encoded tRNA cysteine 50 (anticodon GCA)64829300748293078Mouse
7488550n-Tcgca44nuclear encoded tRNA cysteine 44 (anticodon GCA)64829743348297504Mouse
7488726n-TCgca27nuclear encoded tRNA cysteine 27 (anticodon GCA)64829895048299021Mouse
7488509n-TCgca6nuclear encoded tRNA cysteine 6 (anticodon GCA)64830245948302530Mouse
7488569n-TCgca17nuclear encoded tRNA cysteine 17 (anticodon GCA)64830346548303536Mouse
7488657n-TCgca7nuclear encoded tRNA cysteine 7 (anticodon GCA)64830546448305535Mouse
7488605n-TCgca16nuclear encoded tRNA cysteine 16 (anticodon GCA)64830872948308800Mouse
7488507n-TCgca26nuclear encoded tRNA cysteine 26 (anticodon GCA)64830970748309778Mouse
7488676n-TCgca9nuclear encoded tRNA cysteine 9 (anticodon GCA)64831149948311570Mouse
7488721n-TCgca25nuclear encoded tRNA cysteine 25 (anticodon GCA)64831301848313089Mouse
7488481n-TCgca2nuclear encoded tRNA cysteine 2 (anticodon GCA)64831653748316606Mouse
7488584n-TCgca45nuclear encoded tRNA cysteine 45 (anticodon GCA)64831751548317586Mouse
7488818n-TCgca24nuclear encoded tRNA cysteine 24 (anticodon GCA)64833284048332911Mouse
7488585n-TCgca23nuclear encoded tRNA cysteine 23 (anticodon GCA)64833610848336179Mouse
7488720n-TCgca22nuclear encoded tRNA cysteine 22 (anticodon GCA)64833709148337162Mouse
7488800n-TCgca14nuclear encoded tRNA cysteine 14 (anticodon GCA)64834061348340684Mouse
7488771n-TCgca5nuclear encoded tRNA cysteine 5 (anticodon GCA)64834158848341659Mouse
7488612n-TCgca21nuclear encoded tRNA cysteine 21 (anticodon GCA)64834976248349833Mouse
7488849n-TCgca20nuclear encoded tRNA cysteine 20 (anticodon GCA)64835401948354090Mouse
7488636n-TCgca46nuclear encoded tRNA cysteine 46 (anticodon GCA)64835585548355926Mouse
7488637n-TCgca11nuclear encoded tRNA cysteine 11 (anticodon GCA)64835685148356922Mouse
7488564n-TCgca19nuclear encoded tRNA cysteine 19 (anticodon GCA)64836353248363603Mouse
2310058Gm7880predicted gene 788064838096148382101Mouse
1315882Krba1KRAB-A domain containing 164839464348419855Mouse
10010399Gm38803predicted gene, 3880364842235848427562Mouse
1557833Zfp467zinc finger protein 46764842769248445992Mouse
1557257SspoSCO-spondin64844623048501262Mouse
1621549Zfp862-pszinc finger protein 862, pseudogene64850433948534832Mouse
5145440Gm10243predicted gene 1024364852345748523885Mouse
1620235Gm7887predicted gene 788764852392248525130Mouse
16114221700026J14RikRIKEN cDNA 1700026J14 gene64853658248537474Mouse
1550183Atp6v0e2ATPase, H+ transporting, lysosomal V0 subunit E264853756948541801Mouse
1622032Lrrc61leucine rich repeat containing 6164855478048570722Mouse
1320451Rarres2retinoic acid receptor responder (tazarotene induced) 264856969648572845Mouse
1622836Gm5111predicted gene 511164858944548590584Mouse
1557278Repin1replication initiator 164859388348599082Mouse
1312621Zfp775zinc finger protein 77564860200748621548Mouse
10015514Gm38804predicted gene, 3880464861102148614414Mouse
9645467Gm30661predicted gene, 3066164861331348617446Mouse
2304166AI854703expressed sequence AI85470364862816748633688Mouse
1622031Gimap8GTPase, IMAP family member 864864718648660875Mouse
14998042Gm44262predicted gene, 4426264866501748665845Mouse
12793390Gm46958predicted gene, 4695864867583248676809Mouse
1619713Gimap9GTPase, IMAP family member 964867612148679116Mouse
1553360Gimap4GTPase, IMAP family member 464868457848692062Mouse
1550092Gimap6GTPase, IMAP family member 664870158348708244Mouse
1558281Gimap7GTPase, IMAP family member 764871862148724636Mouse
2300997Gimap1osGTPase, IMAP family member 1, opposite strand64872927948741313Mouse
1619256Gimap1GTPase, IMAP family member 164873904748743795Mouse
1551178Gimap5GTPase, IMAP family member 564874619748754200Mouse
1622195Gimap3GTPase, IMAP family member 364876446448770851Mouse
9596367Gm30714predicted gene, 3071464879099748793777Mouse
9605442Gm30781predicted gene, 3078164879809048798848Mouse
5143740Gm17834predicted gene, 1783464881902448819602Mouse
733079Tmem176btransmembrane protein 176B64883381148845948Mouse
1321798Tmem176atransmembrane protein 176A64884148348845364Mouse
1619427Gm7932predicted gene 793264886032948866083Mouse
11576562Gm44764predicted gene 4476464886145748903063Mouse
732342Aoc1amine oxidase, copper-containing 164889525548909188Mouse
1551539Doxl1diamine oxidase-like protein 164892989648933687Mouse
15001084Gm24348predicted gene, 2434864893479648934923Mouse
2311979Gm10242predicted gene 1024264893974948944051Mouse
5143018Gm18538predicted gene, 1853864895607048956856Mouse
5142378Gm19172predicted gene, 1917264896278748964175Mouse
1622030Doxl2diamine oxidase-like protein 264897494648978745Mouse
5143021Gm18539predicted gene, 1853964898090648982064Mouse
16074054930563H07RikRIKEN cDNA 4930563H07 gene64898661648999616Mouse
1331910Svs1seminal vesicle secretory protein 164898686148991725Mouse
5142377Gm19173predicted gene, 1917364899521148997650Mouse
15018400Gm52881predicted gene, 5288164901851849020520Mouse
9614156Gm31038predicted gene, 3103864901885749022395Mouse
733525Gpnmbglycoprotein (transmembrane) nmb64903651849058182Mouse
5142301Gm19253predicted gene, 1925364907161649072165Mouse
1315835Malsu1mitochondrial assembly of ribosomal large subunit 164907379549139144Mouse
2294928Gm7890predicted gene 789064907995349081167Mouse
1332348Igf2bp3insulin-like growth factor 2 mRNA binding protein 364908521849215469Mouse
5143558Gm18010predicted gene, 1801064917267249173523Mouse
1607162D030074P21RikRIKEN cDNA D030074P21 gene64920581049213260Mouse
1615001Tra2atransformer 2 alpha64924392149264248Mouse
5143557Gm18011predicted gene, 1801164928654849287286Mouse
1619205Ccdc126coiled-coil domain containing 12664931926949341587Mouse
1619837Fam221afamily with sequence similarity 221, member A64936692149389905Mouse
1557352Stk31serine threonine kinase 3164939550649469506Mouse
5147218Gm17060predicted gene 1706064942374949424967Mouse
2310781Gm5305predicted gene 530564954297949563172Mouse
2306729Rpl19-ps8ribosomal protein L19, pseudogene 864959624149599764Mouse
9665209Gm31226predicted gene, 3122664963363149678455Mouse
11016Npyneuropeptide Y64982271049829507Mouse
5143565Gm18007predicted gene, 1800764985800749858853Mouse
10025540Gm38805predicted gene, 3880565010765550110157Mouse
1323498Mpp6membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)65011022850199154Mouse
1550975Gsdmegasdermin E65020740150263857Mouse
1557486Osbpl3oxysterol binding protein-like 365029332750456354Mouse
15018220Gm52900predicted gene, 5290065038169250389695Mouse
10014602Gm40372predicted gene, 4037265049954950505724Mouse
9600769Gm31279predicted gene, 3127965050369550538015Mouse
15002712Gm26289predicted gene, 2628965053990450540034Mouse
10013688Gm38806predicted gene, 3880665054075750542978Mouse
10425Cycscytochrome c, somatic65056256350566569Mouse
16122545430402O13RikRIKEN cDNA 5430402O13 gene65056664350594865Mouse
9677263Mir6371microRNA 637165057239850572508Mouse
16191444921507P07RikRIKEN cDNA 4921507P07 gene65057330250596852Mouse
10026776Gm38807predicted gene, 3880765060155850603699Mouse
2294146Gm4782predicted gene 478265060863750610694Mouse
1617760Gm8035predicted gene 803565061784650618614Mouse
1617756Gm8038predicted gene 803865061984050621885Mouse
1617754Gm8039predicted gene 803965062574350626456Mouse
5142791Gm18765predicted gene, 1876565062768050628339Mouse
62107Npvfneuropeptide VF precursor65065067250654445Mouse
10015764Gm38808predicted gene, 3880865065985150679482Mouse
2309561Gm3017predicted gene 301765074667950747813Mouse
1612803C530044C16RikRIKEN cDNA C530044C16 gene65077611550814894Mouse
9628366Gm31455predicted gene, 3145565080426550822504Mouse
39128820LOC109279947VISTA enhancer mm40265082111950823589Mouse
12795611Gm45922predicted gene, 4592265088088750882620Mouse
9673092Gm31631predicted gene, 3163165090045550908977Mouse
9680383Gm31579predicted gene, 3157965090640650910424Mouse
39130980LOC109279948VISTA enhancer mm40365092454850926237Mouse
9666267Gm31686predicted gene, 3168665093340150944382Mouse
39129136LOC109279949VISTA enhancer mm40465095695650958238Mouse
10029175Gm38809predicted gene, 3880965097338450990183Mouse
39130996LOC109279950VISTA enhancer mm40565098107150982330Mouse
39129280LOC109279951VISTA enhancer mm40665098396750984810Mouse
12798206Gm46959predicted gene, 4695965098740051068011Mouse
9655745Gm31746predicted gene, 3174665103293551061257Mouse
39130214LOC109279952VISTA enhancer mm40765105177251053273Mouse
9676311Gm32190predicted gene, 3219065109651551100672Mouse
9622754Gm32328predicted gene, 3232865112474751166446Mouse
9660418Gm32246predicted gene, 3224665114200751146083Mouse
10006350Gm38810predicted gene, 3881065115427851154934Mouse
15020639Gm52901predicted gene, 5290165116413351165269Mouse
9660132Gm32403predicted gene, 3240365120091951207351Mouse
10004678Gm38821predicted gene, 3882165122295751280572Mouse
1608325Mir148amicroRNA 148a65126981251269910Mouse
9603953Gm32479predicted gene, 3247965128541451308816Mouse
1614636Gm6559predicted gene 655965137971051392791Mouse
16074280610033M10RikRIKEN cDNA 0610033M10 gene65140096951402617Mouse
1317093Nfe2l3nuclear factor, erythroid derived 2, like 365143266951458772Mouse
1321288Hnrnpa2b1heterogeneous nuclear ribonucleoprotein A2/B165146043451470048Mouse
1557409Cbx3chromobox 365147015451483704Mouse
1314020Snx10sorting nexin 1065152390051590679Mouse
15021693Gm52883predicted gene, 5288365156208551564413Mouse
10034764Gm38811predicted gene, 3881165169497051711205Mouse
39130453LOC109279953VISTA enhancer mm41265185723551858614Mouse
734438Skap2src family associated phosphoprotein 265185916552012549Mouse
8181320Halr1Hoxa adjacent long noncoding RNA 165210294952113684Mouse
2309722Rps8-ps3ribosomal protein S8, pseudogene 365211822152118935Mouse
732851Hoxa1homeobox A165215536752160007Mouse
10047062Hotairm2Hoxa transcript antisense RNA, myeloid-specific 265215690252158529Mouse
5145930Hotairm1Hoxa transcript antisense RNA, myeloid-specific 165215852452162020Mouse
731539Hoxa2homeobox A265216241752164831Mouse
9835404Hoxaas2Hoxa cluster antisense RNA 265216567452169451Mouse
12796968Gm46960predicted gene, 4696065216611252166790Mouse
1557652Hoxa3homeobox A365216905952213067Mouse
5145859Gm15050predicted gene 1505065217288152174059Mouse
1608076LOC115490409uncharacterized LOC11549040965217517952193060Mouse
112697925730596B20RikRIKEN cDNA 5730596B20 gene65217715552180851Mouse
736246Hoxa4homeobox A465218968252191703Mouse
32725986Hoxaas3Hoxa cluster antisense RNA 365220112452213597Mouse
734225Hoxa5homeobox A565220175452204587Mouse
1615194Hoxa6homeobox A665220485852208672Mouse
6903156Miramistral long non-coding RNA65221449152215288Mouse
1557455Hoxa7homeobox A765221562352218573Mouse
1320653Hoxa9homeobox A965222309752227370Mouse
15022040Gm52902predicted gene, 5290265222750452232651Mouse
10033261Gm38812predicted gene, 3881265222752052232310Mouse
1608231Mir196bmicroRNA 196b65223008152230165Mouse
1320376Hoxa10homeobox A1065223119752240854Mouse
1558060Hoxa11homeobox A1165224210552245810Mouse
1608864Hoxa11oshomeobox A11, opposite strand65224524352249769Mouse
1557892Hoxa13homeobox A1365225885352260880Mouse
1616050HottipHoxa distal transcript antisense RNA65226277552267603Mouse
1612289Evx1oseven skipped homeotic gene 1, opposite strand65230838952314832Mouse
1558128Evx1even-skipped homeobox 165231349852318389Mouse
1616948Gm8129predicted pseudogene 812965234669052347003Mouse
39130059LOC110120476VISTA enhancer mm152465236516452368224Mouse
39128753LOC109279862VISTA enhancer mm4865244261752444529Mouse
16126461700094M24RikRIKEN cDNA 1700094M24 gene65249245152500085Mouse
1332315Hibadh3-hydroxyisobutyrate dehydrogenase65254623052640300Mouse
9611659Gm33047predicted gene, 3304765256037852579813Mouse
15554237Gm24355predicted gene, 2435565263923452639355Mouse
15019963Gm52884predicted gene, 5288465269220552692958Mouse
732526Tax1bp1Tax1 (human T cell leukemia virus type I) binding protein 165271369252766780Mouse
1320174Jazf1JAZF zinc finger 165276806553068624Mouse
15020386Gm52904predicted gene, 5290465278504052798829Mouse
9632295Gm15572predicted gene 1557265284293052848794Mouse
15020474Gm52903predicted gene, 5290365286643052874237Mouse
10009725Gm38813predicted gene, 3881365294345452946738Mouse
9626243Gm33219predicted gene, 3321965296515852976549Mouse
2299036Gm15573predicted gene 1557365304585053046433Mouse
9661773Gm33097predicted gene, 3309765306008953067995Mouse
2309518Gm8143predicted gene 814365317055053171738Mouse
39130751LOC115490480small nucleolar RNA SNORA4865319581153195953Mouse
2303903Gm4872predicted gene 487265322116453226599Mouse
9601010Gm33348predicted gene, 3334865326247553268233Mouse
1619836Creb5cAMP responsive element binding protein 565328722653700364Mouse
9624891Gm33580predicted gene, 3358065339512753400425Mouse
15557982Gm25818predicted gene, 2581865343397453434137Mouse
10022354Gm38815predicted gene, 3881565346951253471564Mouse
10021953Gm38814predicted gene, 3881465349353753498278Mouse
9658124Gm33392predicted gene, 3339265358135153592876Mouse
39128684LOC115490491small nucleolar RNA SNORA4065376435853764476Mouse
2310780Gm5306predicted gene 530665377736453778183Mouse
1321954TrilTLR4 interactor with leucine-rich repeats65381546853820825Mouse
11082055Gm16499predicted gene 1649965384489953858947Mouse
15003101Gm22910predicted gene, 2291065387201753872148Mouse
1557438Cpvlcarboxypeptidase, vitellogenic-like65387312153978673Mouse
9602770Gm33716predicted gene, 3371665388103653883101Mouse
16119694921529L05RikRIKEN cDNA 4921529L05 gene65397869154018030Mouse
1332162Chn2chimerin 265403993254301812Mouse
10021690Gm38816predicted gene, 3881665406957154080368Mouse
16106649530036M11RikRIKEN cDNA 9530036M11 gene65413793554152446Mouse
2299035Gm15526predicted gene 1552665417719754177717Mouse
5145353Gm15527predicted gene 1552765424573854254994Mouse
22997549130019P16RikRIKEN cDNA 9130019P16 gene65426968154430221Mouse
9673702Gm34125predicted gene, 3412565431411154314795Mouse
10024243Gm38817predicted gene, 3881765431771954319237Mouse
1323127Prr15proline rich 1565432675654343436Mouse
9646570Gm34169predicted gene, 3416965432971854343436Mouse
1622835Wipf3WAS/WASL interacting protein family, member 365442921854503768Mouse
11667149Gm44026predicted gene, 4402665445884154466705Mouse
1557661Scrn1secernin 165447479454566517Mouse
15020458Gm52863predicted gene, 5286365451241254533060Mouse
1553813Fkbp14FK506 binding protein 1465457760254597344Mouse
1557515Plekha8pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 865459511154645823Mouse
10037916Gm38818predicted gene, 3881865459546654602411Mouse
9672658Gm34249predicted gene, 3424965465721654662558Mouse
1619177Mturnmaturin, neural progenitor differentiation regulator homolog (Xenopus)65468162454703855Mouse
39128960Gm44008predicted gene, 4400865468913554698239Mouse
1622781Znrf2zinc and ring finger 265481691654890224Mouse
1557544Nod1nucleotide-binding oligomerization domain containing 165492394254972674Mouse
15000867Gm24230predicted gene, 2423065497465154974779Mouse
2302840Ggctgamma-glutamyl cyclotransferase65498509554992960Mouse
39130028LOC108695204ES cell cis-regulatory motif 6a65499308254993111Mouse
10007040Gm38539predicted gene, 3853965500212055003998Mouse
1317293Garsglycyl-tRNA synthetase65503800155079504Mouse
9661563Gm34311predicted gene, 3431165506949355071511Mouse
733139Crhr2corticotropin releasing hormone receptor 265509004855133016Mouse
9667234Gm34358predicted gene, 3435865515442955167194Mouse
1550692Inmtindolethylamine N-methyltransferase65517062755174990Mouse
1622834Mindy4MINDY lysine 48 deubiquitinase 465520335055320223Mouse
10005023Gm38819predicted gene, 3881965532563655328395Mouse
10181Aqp1aquaporin 165533629955348555Mouse
10645Ghrhrgrowth hormone releasing hormone receptor65537629555388530Mouse
71785116430584L05RikRIKEN cDNA 6430584L05 gene65539688755412285Mouse
10085Adcyap1r1adenylate cyclase activating polypeptide 1 receptor 165545150155501455Mouse
9655828Gm34441predicted gene, 3444165553704355651785Mouse
2299711Gm3729predicted gene 372965562507955625607Mouse
1557246Neurod6neurogenic differentiation 665567781855681263Mouse
5686576Gm3279predicted gene 327965568457155694574Mouse
9652159Gm34676predicted gene, 3467665570056655705885Mouse
10019522Gm38820predicted gene, 3882065578962155804884Mouse
1618966Itprid1ITPR interacting domain containing 165580529055978743Mouse
733728Ppp1r17protein phosphatase 1, regulatory subunit 1765601749756032689Mouse
5143465Gm18099predicted gene, 1809965606094056061480Mouse
68464Pde1cphosphodiesterase 1C65606979856652510Mouse
9606177Gm34753predicted gene, 3475365636969556375167Mouse
1615272Gm8239predicted gene 823965657409756652508Mouse
15001638Gm24709predicted gene, 2470965658371556583846Mouse
15002916Gm22493predicted gene, 2249365660081856600949Mouse
1557645Lsm5LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated65670106356704699Mouse
1616674Avl9AVL9 cell migration associated65671483956761912Mouse
1321152Kbtbd2kelch repeat and BTB (POZ) domain containing 265677752556797813Mouse
1624437Gm10209predicted gene 1020965679444856798426Mouse
1557781Fkbp9FK506 binding protein 965683205956879360Mouse
1323775Nt5c35'-nucleotidase, cytosolic III65688240056924008Mouse
1617412Vmn1r4vomeronasal 1 receptor 465692391456957608Mouse
1617414Vmn1r5vomeronasal 1 receptor 565697033556986350Mouse
1617413Vmn1r6vomeronasal 1 receptor 665700235557003266Mouse
1614721Vmn1r7vomeronasal 1 receptor 765702433857025273Mouse
1616636Vmn1r8vomeronasal 1 receptor 865703591357037125Mouse
1616637Vmn1r9vomeronasal 1 receptor 965707089557071945Mouse
1618217Vmn1r10vomeronasal 1 receptor 1065711342557114360Mouse
1618216Vmn1r11vomeronasal 1 receptor 1165713735357138252Mouse
1615386Vmn1r12vomeronasal 1 receptor 1265715892057159843Mouse
1618215Vmn1r-ps8vomeronasal 1 receptor, pseudogene 865718848857189441Mouse
1557509Vmn1r13vomeronasal 1 receptor 1365720985857210760Mouse
1618214Vmn1r14vomeronasal 1 receptor 1465722615557234350Mouse
1557839Vmn1r15vomeronasal 1 receptor 1565725814957259048Mouse
2309060Vmn1r-ps9vomeronasal 1 receptor, pseudogene 965727802257278668Mouse
1618206Vmn1r-ps10vomeronasal 1 receptor, pseudogene 1065731294057313658Mouse
1616638Vmn1r16vomeronasal 1 receptor 1665732073957323635Mouse
1557618Vmn1r17vomeronasal 1 receptor 1765736046757361378Mouse
1617407Vmn1r18vomeronasal 1 receptor 1865738966857390567Mouse
1558554Vmn1r19vomeronasal 1 receptor 1965740446457405390Mouse
1614720Vmn1r20vomeronasal 1 receptor 2065743169157432602Mouse
2309258Vmn1r-ps11vomeronasal 1 receptor, pseudogene 1165744736457448326Mouse
16076244930533I22RikRIKEN cDNA 4930533I22 gene65746407357506503Mouse
39128602Gm50628predicted gene, 5062865747776857484179Mouse
1552216Ppm1kprotein phosphatase 1K (PP2C domain containing)65750650257535552Mouse
1557741Herc6hect domain and RLD 665758099257665136Mouse
5142302Gm19244predicted gene, 1924465761697257617308Mouse
1557913PyurfPigy upstream reading frame65768473957692078Mouse
1321927Lancl2LanC (bacterial lantibiotic synthetase component C)-like 265770245557739449Mouse
1315143Vopp1vesicular, overexpressed in cancer, prosurvival protein 165775226457827983Mouse
1558171Vmn1r21vomeronasal 1 receptor 2165784356457844457Mouse
14998829Gm25726predicted gene, 2572665785982057859948Mouse
2295910Vmn1r-ps12vomeronasal 1 receptor, pseudogene 1265787241657872916Mouse
1617410Vmn1r22vomeronasal 1 receptor 2265790008257900990Mouse
1617409Vmn1r23vomeronasal 1 receptor 2365792588357926791Mouse
2308972Gm3382predicted gene 338265795007557950469Mouse
1558183Vmn1r24vomeronasal 1 receptor 2465795564157956531Mouse
1618213Vmn1r25vomeronasal 1 receptor 2565797839457979302Mouse
4872548Vmn1r-ps13vomeronasal 1 receptor, pseudogene 1365799299057993584Mouse
1617415Vmn1r26vomeronasal 1 receptor 2665800818358009202Mouse
1619490Rps15-ps2ribosomal protein S15, pseudogene 265801747758017757Mouse
2310876Vmn1r-ps14vomeronasal 1 receptor, pseudogene 1465804893958049847Mouse
2310875Vmn1r-ps15vomeronasal 1 receptor, pseudogene 1565807717358078082Mouse
2310874Gm6695predicted gene 669565809116658092668Mouse
3753467Vmn1r-ps16vomeronasal 1 receptor, pseudogene 1665810801958108252Mouse
2309248Vmn1r-ps17vomeronasal 1 receptor, pseudogene 1765811572958116630Mouse
2308962Vmn1r-ps18vomeronasal 1 receptor, pseudogene 1865820604758206997Mouse
1616635Vmn1r27vomeronasal 1 receptor 2765821510658216017Mouse
2310777Vmn1r-ps19vomeronasal 1 receptor, pseudogene 1965825664358257547Mouse
1617408Vmn1r28vomeronasal 1 receptor 2865826230758266660Mouse
1557235Vmn1r29vomeronasal 1 receptor 2965830729758308208Mouse
2294108Vmn1r-ps20vomeronasal 1 receptor, pseudogene 2065840642058407356Mouse
1617411Vmn1r30vomeronasal 1 receptor 3065843484858443624Mouse
4847783Vmn1r-ps21vomeronasal 1 receptor, pseudogene 2165845509758455993Mouse
1621803Vmn1r31vomeronasal 1 receptor 3165847196758472878Mouse
2309176Vmn1r-ps22vomeronasal 1 receptor, pseudogene 2265849434058495247Mouse
9651316Gm35077predicted gene, 3507765849795658533690Mouse
4804069Vmn1r-ps23vomeronasal 1 receptor, pseudogene 2365850448358504695Mouse
12793394Gm45943predicted gene, 4594365853547058584255Mouse
1551496Abcg2ATP binding cassette subfamily G member 2 (Junior blood group)65858449158692451Mouse
10024217Gm38822predicted gene, 3882265875834558813748Mouse
1317208Herc3hect domain and RLD 365883145558920398Mouse
1615911Nap1l5nucleosome assembly protein 1-like 565890523358907126Mouse
1320344Fam13afamily with sequence similarity 13, member A65893353659024502Mouse
9592463BB365896expressed sequence BB36589665896214958992320Mouse
16074698430415O14RikRIKEN cDNA 8430415O14 gene65896519958991913Mouse
15022572Gm52905predicted gene, 5290565902016759024910Mouse
5142387Gm19165predicted gene, 1916565903688859039379Mouse
15001925Gm22367predicted gene, 2236765909925359099384Mouse
1557040Tigd2tigger transposable element derived 265920887059212033Mouse
1622029Gprin3GPRIN family member 365934450059426306Mouse
9680926Gm35195predicted gene, 3519565969816759705903Mouse
15003070Gm22622predicted gene, 2262265970574659705874Mouse
1619523Gm6732predicted gene 673265986294459971395Mouse
5143554Gm18012predicted gene, 1801265994233159945535Mouse
14996435Gm22723predicted gene, 2272366007105860071186Mouse
11083851Gm5570predicted gene 557066007801960150045Mouse
12797560Gm46985predicted gene, 4698566017914260181776Mouse
14999814n-R5s162nuclear encoded rRNA 5S 16266025079260250910Mouse
9604793Gm35335predicted gene, 3533566033980560374268Mouse
2290332A530053G22RikRIKEN cDNA A530053G22 gene66039716660403707Mouse
10021360Gm38823predicted gene, 3882366041119660449685Mouse
9606201Gm35386predicted gene, 3538666058677260591672Mouse
735748Sncasynuclein, alpha66073157360829855Mouse
1619526Mageb16-ps2MAGE family member B16, pseudogene 266076951960771180Mouse
1618329Mmrn1multimerin 166094431760989378Mouse
5142716Gm18838predicted gene, 1883866101665361017820Mouse
1607733A730020E08RikRIKEN cDNA A730020E08 gene66117560461180810Mouse
1618965Ccser1coiled-coil serine rich 166117996062382863Mouse
5142310Gm19237predicted gene, 1923766258210362583184Mouse
5143020Gm18540predicted gene, 1854066282010262820631Mouse
2302728Gm5001predicted gene 500166292909762929451Mouse
5142423Gm19131predicted gene, 1913166304612863046733Mouse
2309085Nasp-ps1nuclear autoantigenic sperm protein (histone-binding), pseudogene 166316027463161076Mouse
15002846Gm22212predicted gene, 2221266320004363200146Mouse
12793683Gm46990predicted gene, 4699066324582063249368Mouse
10040007Gm38520predicted gene, 3852066325313263256938Mouse
68528Grid2glutamate receptor, ionotropic, delta 266325600664704321Mouse
9618538Gm35705predicted gene, 3570566332199963327996Mouse
5138129Gm20144predicted gene, 2014466409208464092306Mouse
14996372Gm25205predicted gene, 2520566441364864413750Mouse
9597098Gm35851predicted gene, 3585166470434364728861Mouse
1558062Atoh1atonal bHLH transcription factor 166472912564731245Mouse
5142711Gm18839predicted gene, 1883966487844764879130Mouse
4110078Lt1lurcher transcript 166489695364899441Mouse
2311753Gm15534predicted gene 1553466499085864991628Mouse
1320089Smarcad1SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 166504259165116061Mouse
737605Hpgdshematopoietic prostaglandin D synthase66511729365144981Mouse
9645097Gm35906predicted gene, 3590666512240765127323Mouse
9637764Gm17147predicted gene 1714766512734265129105Mouse
15001758Gm44419predicted gene, 4441966515088465151303Mouse
2310792Gm3549predicted gene 354966516915565169954Mouse
5138026Gm20177predicted gene, 2017766524727165247693Mouse
39129909LOC110120478VISTA enhancer mm155766530970265311689Mouse
1621705Gm8479predicted gene 847966532812065329149Mouse
1557088Qrfprlpyroglutamylated RFamide peptide receptor like66538129465458150Mouse
5142844Gm18716predicted gene, 1871666541677365417617Mouse
5142637Gm18913predicted gene, 1891366543205265434002Mouse
39128944Gm50629predicted gene, 5062966552533565577161Mouse
1618716Tnip3TNFAIP3 interacting protein 366559039865634040Mouse
9641558Gm36144predicted gene, 3614466566204965671247Mouse
1332106Ndnfneuron-derived neurotrophic factor66567161165712323Mouse
9662791Gm16838predicted gene, 1683866576854465782835Mouse
1318296Prdm5PR domain containing 566577765665937622Mouse
9646869Gm20445predicted gene 2044566588114965883435Mouse
15520364930544G11RikRIKEN cDNA 4930544G11 gene66595257165954014Mouse
14996131Gm23625predicted gene, 2362566598963765989739Mouse
2295131Gm5876predicted gene 587666599563465996539Mouse
9656469Gm36408predicted gene, 3640866614843966272364Mouse
9672538Gm31520predicted gene, 3152066627250566284845Mouse
10040305Gm38824predicted gene, 3882466631101166315679Mouse
16092452610300M13RikRIKEN cDNA 2610300M13 gene66645194366466483Mouse
39131098LOC115490475small nucleolar RNA SNORA4866646998566470126Mouse
5139923Gm19764predicted gene, 1976466649524666516544Mouse
1614986Tpm3-rs3tropomyosin 3, related sequence 366651589166517730Mouse
2309913Gm6786predicted gene 678666652701466528926Mouse
1322051Mad2l1MAD2 mitotic arrest deficient-like 166653522166541107Mouse
1552538Vmn1r32vomeronasal 1 receptor 3266655218366559708Mouse
2295770Gm5307predicted gene 530766657703966578563Mouse
1617416Vmn1r33vomeronasal 1 receptor 3366661165166612568Mouse
2294128Vmn1r34vomeronasal 1 receptor 3466663682366637752Mouse
1617418Vmn1r35vomeronasal 1 receptor 3566667879466679684Mouse
2294742Gm6794predicted gene 679466671167666712192Mouse
1617419Vmn1r36vomeronasal 1 receptor 3666671597266716889Mouse
1617420Vmn1r37vomeronasal 1 receptor 3766673139266732300Mouse
2299549Gm4045predicted gene 404566674596366746408Mouse
2309203Vmn1r-ps24vomeronasal 1 receptor, pseudogene 2466675338166754279Mouse
1617417Vmn1r38vomeronasal 1 receptor 3866677622266777130Mouse
1616341Vmn1r39vomeronasal 1 receptor 3966680441566805332Mouse
9634601Gm36610predicted gene, 3661066684001566842976Mouse
2295609Gm9794predicted pseudogene 979466687526266875764Mouse
16142824930597O21RikRIKEN cDNA 4930597O21 gene66689464466924176Mouse
1319445Gng12guanine nucleotide binding protein (G protein), gamma 1266689639767021361Mouse
9659636Gm36816predicted gene, 3681666698431767008987Mouse
2299546Gm15644predicted gene 1564466701248467012889Mouse
9591720Gm29848predicted gene, 2984866702142367032522Mouse
15554252Gm25260predicted gene, 2526066702704367027176Mouse
736689Gadd45agrowth arrest and DNA-damage-inducible 45 alpha66703509667037407Mouse
1621239E230016M11RikRIKEN cDNA E230016M11 gene66703659967080652Mouse
9592276Gm29928predicted gene, 2992866709193167103262Mouse
11081555A430010J10RikRIKEN cDNA A430010J10 gene66715780167165108Mouse
10005250Gm38825predicted gene, 3882566717868167186692Mouse
1620201Gm8566predicted pseudogene 856666720552367206194Mouse
1620033Serbp1serpine1 mRNA binding protein 166726697967289302Mouse
1552409Il12rb2interleukin 12 receptor, beta 266728598667376293Mouse
39129644LOC115490490small nucleolar RNA SNORA4066730299867303125Mouse
2310940Gm8574predicted gene 857466738441767385341Mouse
1622130Gm4761predicted gene 476166741443167415012Mouse
11576786Gm44083predicted gene, 4408366741766767418053Mouse
1622129Il23rinterleukin 23 receptor66742293267491855Mouse
1553238Tacstd2tumor-associated calcium signal transducer 266753405967535822Mouse
11296851Igkv2-137immunoglobulin kappa chain variable 2-13766755563667556216Mouse
1621288Igkimmunoglobulin kappa chain complex66755563670726754Mouse
16167144930515G16RikRIKEN cDNA 4930515G16 gene66756523467565699Mouse
5131850Igkv1-136immunoglobulin kappa chain variable 1-13666759387667594308Mouse
11323111Igkv1-135immunoglobulin kappa variable 1-13566760974567610508Mouse
2309694Gm9728predicted gene 972866763290067634120Mouse
1622565Rpl18a-ps2ribosomal protein L18A, pseudogene 266764149767641696Mouse
5135611Igkv14-134-1immunoglobulin kappa chain variable 14-134-166771117467711628Mouse
10031089Gm38573predicted gene, 3857366771773667721436Mouse
5135590Igkv17-134immunoglobulin kappa chain variable 17-13466772072967721225Mouse
11284073Igkv1-133immunoglobulin kappa variable 1-13366772491467725661Mouse
2310693Gm5308predicted gene 530866773407167735581Mouse
1622561Rpl18a-ps3ribosomal protein L18A, pseudogene 366774852467748723Mouse
11312628Igkv1-132immunoglobulin kappa variable 1-13266775970067760413Mouse
11295476Igkv1-131immunoglobulin kappa variable 1-13166776603667766772Mouse
5142577Gm18980predicted gene, 1898066777825067779328Mouse
11307234Igkv14-130immunoglobulin kappa variable 14-13066779104667791511Mouse
14998286Gm22425predicted gene, 2242566779243967792576Mouse
14996350Gm24911predicted gene, 2491166780437567804510Mouse
11301426Igkv9-129immunoglobulin kappa variable 9-12966783979367840266Mouse
2310197Igkv9-128immunoglobulin kappa chain variable 9-12866784740967847874Mouse
11337080Igkv17-127immunoglobulin kappa variable 17-12766786115967861659Mouse
5135610Igkv14-126-1immunoglobulin kappa chain variable 14-126-166787601167876477Mouse
2309693Gm9729predicted gene 972966788069667883610Mouse
1621792Igkv14-126immunoglobulin kappa variable 14-12666789617767896642Mouse
14998127Gm25910predicted gene, 2591066789706567897204Mouse
11337962Igkv11-125immunoglobulin kappa variable 11-12566791357367914052Mouse
11310345Igkv9-124immunoglobulin kappa chain variable 9-12466794207667942540Mouse
11271401Igkv9-123immunoglobulin kappa variable 9-12366795423067954690Mouse
11339312Igkv1-122immunoglobulin kappa chain variable 1-12266801674268017488Mouse
11306094Igkv17-121immunoglobulin kappa variable 17-12166803681868037318Mouse
11298877Igkv9-120immunoglobulin kappa chain variable 9-12066804998368050454Mouse
5135618Igkv9-119immunoglobulin kappa chain variable 9-11966805634568056810Mouse
5135617Igkv14-118-2immunoglobulin kappa chain variable 14-118-266806636968066828Mouse
5135589Igkv14-118-1immunoglobulin kappa chain variable 14-118-166808254768083145Mouse
1616384Gm5309predicted gene 530966810308968103433Mouse
5135621Igkv11-118immunoglobulin kappa chain variable 11-11866810541468105880Mouse
11274213Igkv1-117immunoglobulin kappa variable 1-11766812109168121825Mouse
1614719Igkv2-116immunoglobulin kappa variable 2-11666815188568152617Mouse
1621069Igkv1-115immunoglobulin kappa variable 1-11566816079768161716Mouse
5135612Igkv11-114immunoglobulin kappa chain variable66816445968164923Mouse
5135615Igkv2-113immunoglobulin kappa chain variable 2-11366817880168179564Mouse
2309639Gm4873predicted gene 487366821092568215371Mouse
11281536Igkv2-112immunoglobulin kappa variable 2-11266821998168220705Mouse
3793863Igkv14-111immunoglobulin kappa variable 14-11166825640468256869Mouse
14997888Gm25436predicted gene, 2543666825739468257538Mouse
11332537Igkv1-110immunoglobulin kappa variable 1-11066827052768271265Mouse
11322062Igkv2-109immunoglobulin kappa variable 2-10966830243968303158Mouse
2309433Igkv1-108immunoglobulin kappa variable 1-10866831205468312359Mouse
2309432Igkv2-107immunoglobulin kappa variable 2-10766832609868326752Mouse
2309431Igkv11-106immunoglobulin kappa variable 11-10666833952768339995Mouse
5135622Igkv2-105immunoglobulin kappa chain variable 2-10566834866168349441Mouse
2310692Gm5310predicted gene 531066838634168389189Mouse
11336961Igkv16-104immunoglobulin kappa variable 16-10466842560568426072Mouse
11300195Igkv15-103immunoglobulin kappa chain variable 15-10366843746868437925Mouse
5135619Igkv15-102immunoglobulin kappa chain variable 15-10266846612668466590Mouse
11291586Igkv20-101-2immunoglobulin kappa chain variable 20-101-266847488868475098Mouse
5135620Igkv15-101-1immunoglobulin kappa chain variable 15-101-166847908268479573Mouse
5135616Igkv15-101immunoglobulin kappa chain variable 15-10166848142168481718Mouse
11310725Igkv14-100immunoglobulin kappa chain variable 14-10066851901268519477Mouse
14998442Gm25833predicted gene, 2583366853274468532876Mouse
11331975Igkv1-99immunoglobulin kappa variable 1-9966854165868542422Mouse
11331752Igkv12-98immunoglobulin kappa variable 12-9866857076368571235Mouse
5135624Igkv15-97immunoglobulin kappa chain variable 15-9766859138068591832Mouse
11286321Igkv10-96immunoglobulin kappa variable 10-9666863196568632430Mouse
5144962Igkv2-95-2immunoglobulin kappa variable 2-95-266864799968648531Mouse
5135623Igkv2-95-1immunoglobulin kappa chain variable66867075268671335Mouse
11331976Igkv10-95immunoglobulin kappa variable 10-9566868037968680848Mouse
11268802Igkv10-94immunoglobulin kappa variable 10-9466870450868704978Mouse
5135628Igkv2-93-1immunoglobulin kappa chain variable 2-93-166871292568713508Mouse
10011267Gm40414predicted gene, 4041466873416268735777Mouse
11256436Igkv19-93immunoglobulin kappa chain variable 19-9366873629768736764Mouse
11323867Igkv4-92immunoglobulin kappa variable 4-9266875503868755593Mouse
11275485Igkv4-91immunoglobulin kappa chain variable 4-9166876855568769103Mouse
11260860Igkv4-90immunoglobulin kappa chain variable 4-9066880718068807708Mouse
5135627Igkv13-89-1immunoglobulin kappa chain variable 13-89-166881049568810543Mouse
11320626Igkv12-89immunoglobulin kappa chain variable 12-8966883484668835307Mouse
11326334Igkv1-88immunoglobulin kappa chain variable 1-8866886226568863031Mouse
39130854LOC108169192uncharacterized LOC10816919266887573468880699Mouse
5135630Igkv13-87immunoglobulin kappa variable 13-8766890280168903266Mouse
11296688Igkv4-86immunoglobulin kappa variable 4-8666891041168910938Mouse
11265083Igkv13-85immunoglobulin kappa chain variable 13-8566893026968930734Mouse
11323130Igkv13-84immunoglobulin kappa chain variable 13-8466893960268940067Mouse
5135625Igkv4-83immunoglobulin kappa chain variable 4-8366896137868962019Mouse
5135626Igkv13-82immunoglobulin kappa chain variable 13-8266897919868979663Mouse
11302517Igkv4-81immunoglobulin kappa variable 4-8166899075868991294Mouse
5135631Igkv13-80-1immunoglobulin kappa chain variable 13-80-166900914369009513Mouse
11266468Igkv4-80immunoglobulin kappa variable 4-8066901655869017080Mouse
11323633Igkv4-79immunoglobulin kappa variable 4-7966904297269043505Mouse
1619507Igkv13-78-1immunoglobulin kappa variable 13-78-166905144469051794Mouse
11274210Igkv4-78immunoglobulin kappa variable 4-7866905969069060224Mouse
1617710Igkv4-77immunoglobulin kappa variable 4-7766911090469111432Mouse
5135629Igkv13-76immunoglobulin kappa chain variable 13-7666913786669138332Mouse
5135634Igkv4-75immunoglobulin kappa chain variable 4-7566915611869156659Mouse
5135635Igkv13-74-1immunoglobulin kappa chain variable 13-74-166917741669177787Mouse
11254673Igkv4-74immunoglobulin kappa variable 4-7466918482669185361Mouse
5135632Igkv13-73-1immunoglobulin kappa chain variable 13-73-166919007369190282Mouse
11258931Igkv4-73immunoglobulin kappa variable 4-7366919758369198116Mouse
11260859Igkv4-72immunoglobulin kappa chain variable 4-7266922685469227383Mouse
5135633Igkv13-71-1immunoglobulin kappa chain variable 13-71-166923592769236158Mouse
11279676Igkv4-71immunoglobulin kappa chain variable 4-7166924316069243688Mouse
2292350Igkv4-70immunoglobulin kappa chain variable 4-7066926788869268412Mouse
11273793Igkv4-69immunoglobulin kappa variable 4-6966928379469284319Mouse
11335632Igkv4-68immunoglobulin kappa variable 4-6866930483469305363Mouse
2309185Igkv12-67immunoglobulin kappa chain variable 12-6766932417769324646Mouse
1612752Rprl1ribonuclease P RNA-like 166932693769327174Mouse
5135637Igkv12-66immunoglobulin kappa chain variable 12-6666933460469335076Mouse
2310659Igkv4-65immunoglobulin kappa chain variable 4-6566934247269343004Mouse
5135639Igkv13-64immunoglobulin kappa chain variable 13-6466936272269363187Mouse
11289333Igkv4-63immunoglobulin kappa variable 4-6366937794469378472Mouse
5135638Igkv13-62-1immunoglobulin kappa chain variable 13-62-166939243969392815Mouse
11299266Igkv4-62immunoglobulin kappa variable 4-6266939981269400344Mouse
5135636Igkv13-61-1immunoglobulin kappa chain variable 13-61-166940949969409875Mouse
11308906Igkv4-61immunoglobulin kappa chain variable 4-6166941689369417425Mouse
11338434Igkv4-59immunoglobulin kappa variable 4-5966943821869438741Mouse
11265448Igkv4-60immunoglobulin kappa variable 4-6066946328869463725Mouse
11285800Igkv4-58immunoglobulin kappa variable 4-5866950025469500758Mouse
5135704Igkv13-57-2immunoglobulin kappa variable 13-57-266952373969524016Mouse
11327044Igkv4-57-1immunoglobulin kappa variable 4-57-166954436869544892Mouse
5135644Igkv13-57-1immunoglobulin kappa chain variable 13-57-166956973769570109Mouse
11328003Igkv4-57immunoglobulin kappa variable 4-5766957597569576500Mouse
5135641Igkv13-56-1immunoglobulin kappa chain variable 13-56-166958124469581452Mouse
5144965Igkv4-56immunoglobulin kappa chain variable 4-5666958729569587810Mouse
5135642Igkv13-55-1immunoglobulin kappa chain variable 13-55-166959988669600262Mouse
11312633Igkv4-55immunoglobulin kappa variable 4-5566960727569607801Mouse
5135643Igkv13-54-1immunoglobulin kappa chain variable 13-54-166961704869617423Mouse
11329183Igkv4-54immunoglobulin kappa chain variable 4-5466963164869632178Mouse
11300452Igkv4-53immunoglobulin kappa variable 4-5366964882469649354Mouse
11269956Igkv4-51immunoglobulin kappa chain variable 4-5166968140669681939Mouse
11294624Igkv4-50immunoglobulin kappa variable 4-5066970076769701287Mouse
5135646Igkv12-49immunoglobulin kappa chain variable 12-4966971649869716956Mouse
11292202Igkv5-48immunoglobulin kappa variable 5-4866972657369727125Mouse
1614718Igkv12-47immunoglobulin kappa variable 12-4766975085469751310Mouse
11334545Igkv12-46immunoglobulin kappa variable 12-4666976452369764992Mouse
11324024Igkv5-45immunoglobulin kappa chain variable 5-4566977575069776306Mouse
11268801Igkv12-44immunoglobulin kappa variable 12-4466981463169815100Mouse
11282839Igkv5-43immunoglobulin kappa chain variable 5-4366982335569823911Mouse
5135640Igkv12-42immunoglobulin kappa chain variable 12-4266983479269835245Mouse
11259427Igkv12-41immunoglobulin kappa chain variable 12-4166985842069858884Mouse
5135645Igkv5-40-1immunoglobulin kappa chain variable 5-40-166986859569869193Mouse
2309742Igkv12-40immunoglobulin kappa chain variable 12-4066987935069879819Mouse
11292203Igkv5-39immunoglobulin kappa variable 5-3966990042469900977Mouse
11288194Igkv12-38immunoglobulin kappa chain variable 12-3866994318669943648Mouse
11321108Igkv5-37immunoglobulin kappa variable 5-3766996331269963861Mouse
11305484Igkv18-36immunoglobulin kappa chain variable 18-3666999246569992977Mouse
11326598Igkv1-35immunoglobulin kappa variable 1-3567001094970011673Mouse
11295611Igkv8-34immunoglobulin kappa variable 8-3467004411270044678Mouse
11277874Igkv7-33immunoglobulin kappa chain variable 7-3367005863270059199Mouse
1616906Igkv6-32immunoglobulin kappa variable 6-3267007402470074584Mouse
2309202Igkv8-31immunoglobulin kappa chain variable 8-3167010586070106179Mouse
1626273Igkv8-30immunoglobulin kappa chain variable 8-3067011706170117617Mouse
2292359Amd-ps2S-adenosylmethionine decarboxylase, pseudogene 267013067670132505Mouse
11256051Igkv6-29immunoglobulin kappa chain variable 6-2967013846270139082Mouse
11289560Igkv8-28immunoglobulin kappa variable 8-2867014359370144161Mouse
11266467Igkv8-27immunoglobulin kappa chain variable 8-2767017180970172270Mouse
11322061Igkv8-26immunoglobulin kappa variable 8-2667019322870193797Mouse
2310499Gm8828predicted gene 882867020953370215165Mouse
11279540Igkv6-25immunoglobulin kappa chain variable 6-2567021543370215957Mouse
11315446Igkv8-24immunoglobulin kappa chain variable 8-2467021685870217421Mouse
12796362Gm46962predicted gene, 4696267021884670220704Mouse
11329445Igkv8-23-1immunoglobulin kappa variable 8-23-167024042770240710Mouse
11312266Igkv6-23immunoglobulin kappa variable 6-2367026040970260933Mouse
2310496Gm8836predicted gene 883667026194970263930Mouse
5135607Igkv8-22immunoglobulin kappa chain variable 8-2267029755470298119Mouse
11291768Igkv8-21immunoglobulin kappa variable 8-2167031489570315452Mouse
1616131Amd-ps5S-adenosylmethionine decarboxylase, pseudogene 567032654270329888Mouse
11334399Igkv6-20immunoglobulin kappa variable 6-2067033584170336479Mouse
11282345Igkv8-19immunoglobulin kappa variable 8-1967034087670341448Mouse
11328230Igkv8-18immunoglobulin kappa variable 8-1867035587770356445Mouse
2310489Gm8848predicted gene 884867036843970369799Mouse
11268803Igkv6-17immunoglobulin kappa variable 6-1767037146970371993Mouse
11261517Igkv8-16immunoglobulin kappa variable 8-1667038667270387238Mouse
11309138Igkv6-15immunoglobulin kappa variable 6-1567040646970406992Mouse
2310487Gm8853predicted gene 885367040863070410009Mouse
2312028Gm6157predicted gene 615767042892270431214Mouse
1557441Igkv6-14immunoglobulin kappa variable 6-1467043495270435476Mouse
2310485Gm8862predicted gene 886267043711070438473Mouse
11271654Igkv6-13immunoglobulin kappa variable 6-1367045750370458036Mouse
2310402Gm8872predicted gene 887267045966470461022Mouse
2310401Igkv3-12-1immunoglobulin kappa chain variable 3-12-167049766270498342Mouse
11329739Igkv3-12immunoglobulin kappa variable 3-1267051825070518849Mouse
1615260Igkv3-11immunoglobulin kappa variable 3-1167055327470554440Mouse
11287592Igkv3-10immunoglobulin kappa variable 3-1067057263370573230Mouse
11302593Igkv3-9immunoglobulin kappa variable 3-967058818970588777Mouse
1625481Igkv3-8immunoglobulin kappa variable 3-867058887170589452Mouse
11273769Igkv3-7immunoglobulin kappa variable 3-767060743770608036Mouse
1615251Igkv3-6immunoglobulin kappa variable 3-667064240570643565Mouse
11264055Igkv3-5immunoglobulin kappa chain variable 3-567066329870663895Mouse
11329277Igkv3-4immunoglobulin kappa variable 3-467067178970672377Mouse
11270245Igkv3-3immunoglobulin kappa variable 3-367068694670687534Mouse
11289858Igkv3-2immunoglobulin kappa variable 3-267069846870699067Mouse
11296073Igkv3-1immunoglobulin kappa variable 3-167070357870704177Mouse
12798133Gm46961predicted gene, 4696167071307970718876Mouse
39130097LOC115490474small nucleolar RNA SNORA4867071632370716471Mouse
11303386Igkj1immunoglobulin kappa joining 167072256270722599Mouse
11268429Igkj2immunoglobulin kappa joining 267072291670722954Mouse
11291103Igkj3immunoglobulin kappa joining 367072322370723260Mouse
11313816Igkj4immunoglobulin kappa joining 467072354870723585Mouse
11269802Igkj5immunoglobulin kappa joining 567072388670723923Mouse
10783Igkcimmunoglobulin kappa constant67072643570726754Mouse
9664259Gm30211predicted gene, 3021167072921370751690Mouse
1322806Rpiaribose 5-phosphate isomerase A67076572070792175Mouse
9639449Gm30331predicted gene, 3033167080699170814791Mouse
736260Eif2ak3eukaryotic translation initiation factor 2 alpha kinase 367084448470905241Mouse
15001446Gm23346predicted gene, 2334667085544470855579Mouse
1623159Tex37testis expressed 3767091308970951095Mouse
9586081Foxi3forkhead box I367095660670961066Mouse
39128325LOC115490477small nucleolar RNA SNORA4867100312371003262Mouse
14996021Gm23485predicted gene, 2348567103957771039733Mouse
10034617Gm38826predicted gene, 3882667108777771106633Mouse
1625321Rpl34-ps1ribosomal protein L34, pseudogene 167112458971125001Mouse
1319322Thnsl2threonine synthase-like 2 (bacterial)67112816671144380Mouse
9609356Gm30391predicted gene, 3039167114858971153688Mouse
10039264Gm38827predicted gene, 3882767115410571157968Mouse
10563Fabp1fatty acid binding protein 1, liver67119987971205034Mouse
1552115Smyd1SET and MYND domain containing 167121394071262281Mouse
9634058Mir8112microRNA 811267127167171271801Mouse
1315144Krcc1lysine-rich coiled-coil 167127167771286825Mouse
1617196Gm1070predicted gene 107067129376571302880Mouse
10035554Gm38828predicted gene, 3882867131220971322657Mouse
1553149Cd8b1CD8 antigen, beta chain 167132278871337492Mouse
39129532Cd8_civCd8 alpha DNase I hypersensitive cluster CIV67132955271343641Mouse
39130562Cd8_ciiiCd8 alpha DNase I hypersensitive cluster CIII67135100871361800Mouse
10016584Gm38829predicted gene, 3882967135301771361499Mouse
39130438Cd8_ciiCd8 alpha DNase I hypersensitive cluster CII67136841171373810Mouse
10317Cd8aCD8 antigen, alpha chain67137342771379171Mouse
1320277Rmnd5arequired for meiotic nuclear division 5 homolog A67138863471440637Mouse
9630997Gm30582predicted gene, 3058267145750271479149Mouse
731597Rnf103ring finger protein 10367149384471510880Mouse
10039046Gm38830predicted gene, 3883067153321971537869Mouse
1553078Chmp3charged multivesicular body protein 367154383171582609Mouse
737255Kdm3alysine (K)-specific demethylase 3A67158897071632990Mouse
2294455Gm6063predicted gene 606367164140771642137Mouse
11576868Gm44768predicted gene 4476867167209571672699Mouse
2295283Rpl19-ps9ribosomal protein L19, pseudogene 967168326971683976Mouse
1313135Reep1receptor accessory protein 167170742971810710Mouse
1316035Mrpl35mitochondrial ribosomal protein L3567181299771823784Mouse
1321730Immtinner membrane protein, mitochondrial67183109171875266Mouse
5143751Gm17825predicted gene, 1782567186917071870024Mouse
1557081Ptcd3pentatricopeptide repeat domain 367188063871908773Mouse
25824929Snord94small nucleolar RNA, C/D box 9467188255771882693Mouse
733035Polr1apolymerase (RNA) I polypeptide A67190905371979435Mouse
5142472Gm19078predicted gene, 1907867191890171919844Mouse
9626419Gm26628predicted gene, 2662867196113571963775Mouse
39130811LOC114827915VISTA enhancer mm172267198933371992061Mouse
48903359130221F21RikRIKEN cDNA 9130221F21 gene67201389672042528Mouse
2310302Gm8952predicted gene 895267207285572074238Mouse
1552922St3gal5ST3 beta-galactoside alpha-2,3-sialyltransferase 567209755272154571Mouse
16087774933431G14RikRIKEN cDNA 4933431G14 gene67212021372123197Mouse
10007228Gm38831predicted gene, 3883167215434472158884Mouse
10015811Gm38832predicted gene, 3883267216191272167826Mouse
1557505Atoh8atonal bHLH transcription factor 867220617472235780Mouse
39128839LOC109279908VISTA enhancer mm12367221518672218828Mouse
15017676Gm52906predicted gene, 5290667223162272232728Mouse
9628717Gm30782predicted gene, 3078267225009772254928Mouse
737198Sftpbsurfactant associated protein B67230461072314373Mouse
1317683Usp39ubiquitin specific peptidase 3967231867672345208Mouse
16183560610030E20RikRIKEN cDNA 0610030E20 gene67234703472353162Mouse
732337Tmem150atransmembrane protein 150A67235548372359762Mouse
1551424Rnf181ring finger protein 18167235971272366994Mouse
732080Vamp5vesicle-associated membrane protein 567236804972380468Mouse
9670539Gm30872predicted gene, 3087267237764772385563Mouse
15020286Gm52494predicted gene, 5249467237928172385218Mouse
731713Vamp8vesicle-associated membrane protein 867238522172390667Mouse
68555Ggcxgamma-glutamyl carboxylase67241427972433359Mouse
732781Mat2amethionine adenosyltransferase II, alpha67243279672439556Mouse
1613016Particlpromoter of Mat2a antisense radiation induced circulating long non-coding RNA67243868372440615Mouse
1558250Sh2d6SH2 domain containing 667251364172534206Mouse
1323331Capgcapping protein (actin filament), gelsolin-like67253828272562983Mouse
1558565Elmod3ELMO/CED-12 domain containing 367256592272598431Mouse
731875Retsatretinol saturase (all trans retinol 13,14 reductase)67259860272607488Mouse
1624067Tgoln1trans-golgi network protein67260842072617000Mouse
1323252Tcf7l1transcription factor 7 like 1 (T cell specific, HMG box)67262637172789045Mouse
1624459Gm15401predicted gene 1540167262928872637717Mouse
9615740Gm31391predicted gene, 3139167265525572691939Mouse
9656664Gm31315predicted gene, 3131567268801672688278Mouse
39130464LOC110120473VISTA enhancer mm147467271017972712952Mouse
9673370Gm31249predicted gene, 3124967273984372750022Mouse
10027329Gm38833predicted gene, 3883367278346172786543Mouse
1315005Kcmf1potassium channel modulatory factor 167284111472899979Mouse
62314Tmsb10thymosin, beta 1067295734772958748Mouse
5143156Gm18402predicted gene, 1840267298247772983010Mouse
9654282Gm31547predicted gene, 3154767300710073010731Mouse
11083073Gm20560predicted gene, 2056067301191073033805Mouse
1551162Dnah6dynein, axonemal, heavy chain 667301760373222227Mouse
15000745Gm24533predicted gene, 2453367314148573141680Mouse
10009299Gm40377predicted gene, 4037767322279773225834Mouse
731610Suclg1succinate-CoA ligase, GDP-forming, alpha subunit67324850573276907Mouse
10006442Gm38834predicted gene, 3883467324876373254494Mouse
10012156Gm40378predicted gene, 4037867328760373289836Mouse
1619762Olfr210-ps1olfactory receptor 210, pseudogene 167342031773421218Mouse
16108311700065L07RikRIKEN cDNA 1700065L07 gene67343696573471021Mouse
15574504931417E11RikRIKEN cDNA 4931417E11 gene67346857373469667Mouse
2307811Gm4374predicted gene 437467352881173529238Mouse
9652121Gm31747predicted gene, 3174767358610973608673Mouse
14997548Gm26179predicted gene, 2617967434095074341081Mouse
15001206Gm23924predicted gene, 2392467445179774451904Mouse
1613693Gm8992predicted gene 899267518739075188492Mouse
2295178Gm8993predicted gene 899367520207175202839Mouse
2294126Gm6210predicted gene 621067529603575298137Mouse
2310217Gm8999predicted gene 899967538286575384070Mouse
10036748Gm38835predicted gene, 3883567542745075474984Mouse
1613688Gm9001predicted gene 900167578216275782780Mouse
9622476Gm31806predicted gene, 3180667590359075905810Mouse
1616340Gm5995predicted gene 599567612160876123084Mouse
14998030Gm22283predicted gene, 2228367620011876200278Mouse
11576482Gm44163predicted gene, 4416367645521876455922Mouse
2295176Gm9007predicted gene 900767645539076455922Mouse
1613684Gm9008predicted pseudogene 900867649544576497733Mouse
15021822Gm52943predicted gene, 5294367663265876632796Mouse
10031689Gm38836predicted gene, 3883667669545276711577Mouse
9642232Gm31860predicted gene, 3186067681033676815549Mouse
1619285Ctnna2catenin (cadherin associated protein), alpha 267688163777979815Mouse
1622254Lrrtm1leucine rich repeat transmembrane neuronal 167722921077259915Mouse
16199936330415B21RikRIKEN cDNA 6330415B21 gene67738025777382475Mouse
10028702Gm38837predicted gene, 3883767759873977605174Mouse
7178448Gm21045predicted gene, 2104567806857478069593Mouse
1614717Gm5576predicted pseudogene 557667821587878217169Mouse
11057Reg3bregenerating islet-derived 3 beta67837088578373466Mouse
1623258Reg3dregenerating islet-derived 3 delta67837587478378865Mouse
733989Reg3aregenerating islet-derived 3 alpha67838070978383839Mouse
1623283Reg2regenerating islet-derived 267840515578408099Mouse
737019Reg1regenerating islet-derived 167842598378428668Mouse
15022837Gm52853predicted gene, 5285367845062478453984Mouse
1552800Reg3gregenerating islet-derived 3 gamma67846626978468874Mouse
7179683Gm21392predicted gene, 2139267848043178483470Mouse
2294443Gm6072predicted gene 607267849676178497477Mouse
14998839Gm23727predicted gene, 2372767891116778911330Mouse
5135778Gm20362predicted gene, 2036267903204279035869Mouse
2310691Gm5311predicted gene 531167904811179048985Mouse
2310880Gm6261predicted gene 626167954119379542056Mouse
5683775Gm20594predicted gene, 2059467981803179818364Mouse
1621287Lrrtm4leucine rich repeat transmembrane neuronal 468001885880810162Mouse
14999406Gm44240predicted gene, 4424068004169880051619Mouse
9593260Gm32091predicted gene, 3209168014041980166659Mouse
10008651Gm40379predicted gene, 4037968014495280146564Mouse
10015341Gm38838predicted gene, 3883868142899781446257Mouse
14999356Gm26264predicted gene, 2626468163831181638469Mouse
10005180Gm38839predicted gene, 3883968170721781716200Mouse
9634478Gm32223predicted gene, 3222368171846181729327Mouse
15001538Gm22530predicted gene, 2253068180679181806908Mouse
2294494Gm4874predicted gene 487468184073481841362Mouse
10038037Gm38840predicted gene, 3884068186424181875912Mouse
9629794Mir7232microRNA 723268189559081895663Mouse
1608184Mir468microRNA 46868189659981896676Mouse
16231601700009C05RikRIKEN cDNA 1700009C05 gene68190046581910800Mouse
1312441Gcfc2GC-rich sequence DNA binding factor 268191056281959098Mouse
10030257Gm38841predicted gene, 3884168191358881920429Mouse
1558315Mrpl19mitochondrial ribosomal protein L1968195782681965949Mouse
10027134Gm38842predicted gene, 3884268197160081972958Mouse
5136828Gm20383predicted gene, 2038368198432181992426Mouse
9673609Gm32378predicted gene, 3237868202588182033719Mouse
1618148Eva1aeva-1 homolog A (C. elegans)68204104882093099Mouse
10016591Gm40380predicted gene, 4038068208532382088667Mouse
10012162Gm40381predicted gene, 4038168211974982126072Mouse
9623490Gm31861predicted gene, 3186168224217482242814Mouse
731009Tacr1tachykinin receptor 168240200382560104Mouse
1317191Pole4polymerase (DNA-directed), epsilon 4 (p12 subunit)68261653282653043Mouse
9629826Gm32425predicted gene, 3242568267967782706283Mouse
9668418Gm32534predicted gene, 3253468271078182714930Mouse
9676597Gm32480predicted gene, 3248068271520682715969Mouse
735576Hk2hexokinase 268272502582774454Mouse
10031187Gm38843predicted gene, 3884368280385582805179Mouse
9627580Gm32591predicted gene, 3259168283126582841391Mouse
16103902310069B03RikRIKEN cDNA 2310069B03 gene68287786682881853Mouse
1616304Gm6312predicted gene 631268288726382888720Mouse
735858Sema4fsema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain68291188482939769Mouse
1620665M1apmeiosis 1 associated protein68294690883030309Mouse
5142230Gm19287predicted gene, 1928768295278082953136Mouse
9658423Gm32644predicted gene, 3264468300818183022506Mouse
1319872Dok1docking protein 168303093283033495Mouse
1322240Loxl3lysyl oxidase-like 368303420583052566Mouse
9599844Mir7040microRNA 704068304971183049773Mouse
1318944Htra2HtrA serine peptidase 268305126683054571Mouse
1320623Aup1ancient ubiquitous protein 168305449583057682Mouse
1312376Dqx1DEAQ RNA-dependent ATPase68305774783067313Mouse
1320083Tlx2T cell leukemia, homeobox 268306832583070225Mouse
1557454Pcgf1polycomb group ring finger 168307755283080855Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12904934Edlmmq4_mextensor digitorum longus muscle mass QTL 4 (mouse)6125514064Mouse
12904942Tammq3_mtibialis anterior muscle mass QTL 3 (mouse)6125514064Mouse
12904955Gmmq3_mgastrocnemius muscle mass QTL 3 (mouse)6125514064Mouse
1301131Chol2_mcholesterol 2 (mouse)Not determined6132144496Mouse
5491191Mobq2_mmultigenic obesity QTL 2 (mouse)Not determined6132144496Mouse
1302024Skull7_mskull morphology 7 (mouse)Not determined6132144496Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
15039372Nmrs22_mNAFLD-associated magnetic resonance shift 22 (mouse)6147633535476335Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300731Smdq3_msegregation of mitochondrial DNA QTL 3 (mouse)Not determined6424920738249326Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
11353836Bmiq1_mbody mass index QTL 1 (mouse)6450382329751334Mouse
11353840Bmiq2_mbody mass index QTL 2 (mouse)6450382345314181Mouse
1357481Aaj2_manxiety in A/J 2 (mouse)Not determined6450382348726677Mouse
1357520Axtq2_manxiety QTL 2 (mouse)Not determined6450382348726677Mouse
11353841Bmiq3_mbody mass index QTL 3 (mouse)6450382348726677Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
26884441Sklq3_mskull length QTL 3, 5 week (mouse)6760000080600000Mouse
1302051Sluc7_msusceptibility to lung cancer 7 (mouse)Not determined6929707543297169Mouse
10043869Cia6a_mcollagen induced arthritis QTL 6a (mouse)Not determined61211797246118070Mouse
1301998Bts2_mbladder tumor susceptibility 2 (mouse)Not determined61275122246751334Mouse
4141749Obrq2_mobesity resistance QTL 2 (mouse)Not determined1275122246751334Mouse
27226726Tibmd7_mtibia midshaft diameter 7, 16 week (mouse)61770000053500000Mouse
1301724Pcd4ts1_mp-glycoprotein positive CD4 T cell subset 1 (mouse)Not determined61773466351734784Mouse
4140989Spqq2_msperm quality QTL 2 (mouse)Not determined1773466351734784Mouse
1301850Fglu_mfasting glucose (mouse)Not determined61773466351734784Mouse
1357442Dbts1_mdiabetes 1 (mouse)Not determined61823414873387692Mouse
12904940Edlmmq5_mextensor digitorum longus muscle mass QTL 5 (mouse)61963941153639411Mouse
12904943Tammq4_mtibialis anterior muscle mass QTL 4 (mouse)61963941153639411Mouse
12904952Gmmq4_mgastrocnemius muscle mass QTL 4 (mouse)61963941153639411Mouse
10412213Sxbq2_mSGC/Knj cross B6 QTL 2 (mouse)Not determined61991268671322775Mouse
10412107Desp4_mdespair 4 (mouse)Not determined62007289554072895Mouse
14700690Ccs6_mcolon cancer susceptibility 6 (mouse)62380000057800000Mouse
13208564Bmiq7_mbody mass index QTL 7 (mouse)62500000080000000Mouse
4141988Obrq3_mobesity resistance QTL 3 (mouse)Not determined2831405962314181Mouse
11352717Obrq2a_mobesity resistance QTL 2a (mouse)63171740634870960Mouse
4141454Obrq4_mobesity resistance QTL 4 (mouse)Not determined3172656565726677Mouse
12880425V25Dq5_mvitamin D inactive form serum level QTL 5 (mouse)63270000066700000Mouse
4141782Mrdq5_mmodifier of retinal degeneration QTL 5 (mouse)Not determined3285065078238974Mouse
1300959Lxw2_mlupus BXSB x NZW 2 (mouse)Not determined63389528167895420Mouse
11252142Mom12_mModifier of Min 12 (mouse)63389528167895420Mouse
10043868Cia6b_mcollagen induced arthritis QTL 6b (mouse)Not determined63473466338969603Mouse
1300767Aliq4_macute lung injury QTL 4 (mouse)Not determined63629634770296450Mouse
1357539Bsbob3_mBSB obesity 3 (mouse)Not determined63647147170471591Mouse
4141094Hrtr1_mheart rate 1 (mouse)Not determined3676447870764478Mouse
14746995Manh60_mmandible shape 60 (mouse)63722567771225677Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1301326Trbv4c2_mT cell receptor beta variable 4 (mouse)Not determined64089129671379171Mouse
12880424V25Dq4_mvitamin D inactive form serum level QTL 4 (mouse)64160000075600000Mouse
1301266Lmr4_mleishmaniasis resistance 4 (mouse)Not determined64211637376116515Mouse
11040600Lmr4c_mleishmaniasis resistance 4c (mouse)64211637376116515Mouse
11040601Lmr4a_mleishmaniasis resistance 4a (mouse)64211637376116515Mouse
11533915Mts4_mmammary tumor susceptibility 4 (mouse)64211637376116515Mouse
12910785Pwgrq16_mpost-weaning growth rate QTL 16 (mouse)64382681377811523Mouse
12910798Pwgrq5_mpre-weaning growth rate QTL 5 (mouse)64382681377811523Mouse
12910802Pwbwq12_mpost-weaning body weight QTL 12 (mouse)64382681377811523Mouse
12910807Pwbwq11_mpost-weaning body weight QTL 11 (mouse)64382681377811523Mouse
12910809Pwbwq10_mpost-weaning body weight QTL 10 (mouse)64382681377811523Mouse
12910820Ogrq3_moverall growth rate QTL 3 (mouse)64382681377811523Mouse
10043885Cia6c_mcollagen induced arthritis QTL 6c (mouse)Not determined64446587171119467Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
4140983Srilp_msleep response to influenza, light phase (mouse)Not determined4872655675447710Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
14696807Rbcn2_mrod bipolar cell number 2 (mouse)65121000056210000Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
14700792Mencq5_mmeniscus calcification QTL 5 (mouse)65961500063355000Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
4141990Etax6_methanol induced ataxia 6 (mouse)Not determined7132262186275719Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 668022 UniSTS
  69837 UniSTS
UniSTS 164327 UniSTS