AJ130975 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AJ130975

Symbol: AJ130975
Also known as: 418267; 
RGD ID: 4956796
Expected Size: 133 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389108,604,836 - 108,604,968UniSTSGRCm38
GRCm381159,474,038 - 59,474,170UniSTSGRCm38
MGSCv379108,507,167 - 108,507,299UniSTSGRCm37
MGSCv371159,287,540 - 59,287,672UniSTSGRCm37
Celera9108,216,224 - 108,216,356UniSTS
Cytogenetic Map11B1.3UniSTS
Cytogenetic Map9F2UniSTS
Whitehead/MRC_RH91110.84UniSTS
Is Marker For: Genes:   Arih2   Zfp867   Gm12263  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCCTGAAAGACACTGGCAA
Reverse Primer ACCATCCAGGGGAAATGTAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2295584Gm12263predicted gene 12263115947408759475965Mouse
1314114Arih2ariadne RBR E3 ubiquitin protein ligase 29108602942108653681Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
27226798Scvln18_msacral vertebrae length 2, 16 week (mouse)11330000060800000Mouse
26884446Sklq10_mskull length QTL 10, 10 week (mouse)11330000063000000Mouse
26884453Sklq16_mskull length QTL 16, 16 week (mouse)11330000072800000Mouse
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
27226738Metcl11_mmetatarsal-calcaneal length 11, 10 week (mouse)11890000061500000Mouse
26884401Huml4_mhumerus length 4, 10 week (mouse)111160000068600000Mouse
27226762Feml21_mfemur length 21, 16 week (mouse)111180000066100000Mouse
4141966Tailq1_mtail length QTL 1 (mouse)Not determined1231863768609504Mouse
1357851Scfq3_msubcutaneous fat pad weight QTL 3 (mouse)Not determined111231863768609504Mouse
1357437Epfq4_mepididymal fat pad weight QTL 4 (mouse)Not determined111231863768609504Mouse
4141127W3q4_mweight 3 weeks QTL 4 (mouse)Not determined1231863768609504Mouse
4142216Lgq1_mlate growth QTL 1 (mouse)Not determined1231863768609504Mouse
4142308W6q3_mweight 6 weeks QTL 3 (mouse)Not determined111231863768609504Mouse
4141582Lgaq1_mlate growth adjusted QTL 1 (mouse)Not determined1231863768609504Mouse
4142109W10q2_mweight 10 weeks QTL 2 (mouse)Not determined1231863768609504Mouse
4141470Egq4_mearly growth QTL 4 (mouse)Not determined1231863768609504Mouse
1357640Orq2_movulation rate QTL 2 (mouse)Not determined111231863768609504Mouse
1357720Kidpq1_mkidney weight percentage QTL 1 (mouse)Not determined111231863768609504Mouse
1559002Lmrq4_mLeishmania major resistance QTL 4 (mouse)Not determined111231863769794121Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
1558945Orgwq8_morgan weight QTL 8 (mouse)Not determined111710617567187585Mouse
10053687Eae6_msusceptibility to experimental allergic encephalomyelitis 6 (mouse)Not determined111783196668609504Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
10044006Hbnr13_mHeligmosomoides bakeri nematode resistance 13 (mouse)Not determined112588179959881914Mouse
1357844Si5lq5_mserum IGFBP-5 level QTL 5 (mouse)Not determined112827504662275149Mouse
13524848Ppiq7_mprepulse inhibition QTL 7 (mouse)112867832062678320Mouse
1301426Desp2_mdespair 2 (mouse)Not determined112881775462817873Mouse
11522752Cocia18_mcocaine-induced activity, QTL 18 (mouse)113111738265117382Mouse
11059563Lmr31_mleishmaniasis resistance 31 (mouse)113220975066209867Mouse
1357782Char8_mP. chabaudi malaria resistance QTL 8 (mouse)Not determined113568778969794161Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
1301788Lbw8_mlupus NZB x NZW 8 (mouse)Not determined113661246070618665Mouse
1301896Tria1_mT-cell receptor induced activation 1 (mouse)Not determined113672273870723028Mouse
4141853Skmw17_mskeletal muscle weight 17 (mouse)Not determined113719011571190238Mouse
4142475Ity2a_mimmunity to S. typhimurium 2a (mouse)Not determined113787775360511890Mouse
10766457Nwa3_mNew Zealand White autoimmunity 3 (mouse)113812528972125383Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141084Spqq1_msperm quality QTL 1 (mouse)Not determined5417484463428696Mouse
1302186Blmpf2_mbleomycin-induced pulmonary fibrosis 2 (mouse)Not determined115417484467187585Mouse
4142148Ckdbp2_mchronic kidney disease blood pressure locus 2 (mouse)Not determined115419011565213015Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4141875Etax9_methanol induced ataxia 9 (mouse)Not determined5539415972319101Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
10053682Eae45_mexperimental allergic encephalomyelitis susceptibility 45 (mouse)Not determined115859972974863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
11532697Sluc36_msusceptibility to lung cancer 36 (mouse)115936579169591873Mouse
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13207569Tcq13_mtotal cholesterol QTL 13 (mouse)959990000109260000Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
10054492El7_mepilepsy 7 (mouse)Not determined975775364114474379Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
11081166Psl5_mpromotion susceptibility QTL 5 (mouse)994981301112872929Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
1301192Skts6_mskin tumor susceptibility 6 (mouse)Not determined978640645112640755Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
10401247Bglu14_mblood glucose level 14 (mouse)Not determined979397810113397888Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1302065El1_mepilepsy 1 (mouse)Not determined975775364114474379Mouse
1301732Char1_mP. chabaudi malaria resistance QTL 1 (mouse)Not determined981798268115798392Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
1301407Rapop2_mradiation-induced apoptosis 2 (mouse)Not determined976535936110536130Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
10412180Msam3_mmuscle, skeletal, activity measure 3 (mouse)Not determined985897510108641186Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 237775 UniSTS
  23807 UniSTS
  432565 UniSTS
UniGene Mm.290447 UniSTS
  Mm.390390 UniSTS
UniSTS 163469 UniSTS