X82067 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: X82067

Symbol: X82067
Also known as: 5637; 
RGD ID: 4956748
Expected Size: 102 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38884,974,103 - 84,974,204UniSTSGRCm38
GRCm38199,790,310 - 99,790,411UniSTSGRCm38
MGSCv371101,686,887 - 101,686,988UniSTSGRCm37
MGSCv37887,498,002 - 87,498,103UniSTSGRCm37
Celera889,268,782 - 89,268,883UniSTS
Celera1102,675,564 - 102,675,665UniSTS
Cytogenetic Map8C3UniSTS
Cytogenetic Map1E1.1UniSTS
Cytogenetic Map17A3.3UniSTS
cM Map836.0UniSTS
Whitehead/MRC_RH81011.77UniSTS
Is Marker For: Genes:   Prdx2   Cntnap5b   Prdx2-ps1   Gm5225  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGCCTGAAGCTTGGATTTC
Reverse Primer CTAGACTCCAGCCCCTTCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1618942Cntnap5bcontactin associated protein-like 5B199772246100490599Mouse
2309262Prdx2-ps1peroxiredoxin 2, pseudogene 119979019999791096Mouse
735477Prdx2peroxiredoxin 288496962284974811Mouse

Nucleotide Sequences
RefSeq Transcripts NM_011563 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC158402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC163703 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF032714 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF032722 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC002034 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC081454 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC086783 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV093979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CG784267 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CW916843 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ED562524 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ED562736 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EI392709 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ER987758 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL589802 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL595397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U20611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U51679 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X82067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357847Jckm2_mjuvenile cystic kidney modifier 2 (mouse)Not determined174952818133363199Mouse
1300989Lrdg1_mlight induced retinal degeneration 1 (mouse)Not determined173716016147249632Mouse
1558928Mord2_mmodifier of retinal degeneration 2 (mouse)Not determined177146478110608345Mouse
15039333Nmrs1_mNAFLD-associated magnetic resonance shift 1 (mouse)189858782123858782Mouse
4141627Bwq7_mbody weight, QTL 7 (mouse)Not determined193013187124570059Mouse
13452398Leusq5_mleucocytosis susceptibility QTL 5 (mouse)198547060126458780Mouse
4142394Mssq1_mmandible size and shape QTL 1 (mouse)Not determined73687970107688108Mouse
1357488Splq3_mspleen weight QTL 3 (mouse)Not determined134721057150318120Mouse
13824984Twq5_mtestis weight QTL 5 (mouse)13000000185000000Mouse
1301722Cia9_mcollagen induced arthritis QTL 9 (mouse)Not determined145744740189571420Mouse
1558860W10q7_mweight 10 weeks QTL 7 (mouse)Not determined134721057150318120Mouse
1357439Popoa_mpremature ovulation and primary oocyte arrest (mouse)Not determined182665468135687641Mouse
27095928Pglq6_mpelvic girdle length QTL 6, 10 week (mouse)176000000148900000Mouse
1301536Pbbcp1_mperipheral blood B cell percentage 1 (mouse)Not determined199579930133580115Mouse
1301123Cd8mts2_mCD8 memory T cell subset 2 (mouse)Not determined196690656130690827Mouse
27095918Ulnl1_mulna length 1, 5 week (mouse)167300000129800000Mouse
12050069Nabq1_mnasal bone morphology QTL 1 (mouse)179930958113931066Mouse
4141725Wbcq4_mwhite blood cell quantitative locus 4 (mouse)Not determined179930958113931066Mouse
27095901Scvln8_msacral vertebrae length 2, 10 week (mouse)194200000172200000Mouse
1300976Bmd19_mbone mineral density 19 (mouse)Not determined173227055108910684Mouse
12791004Aath7_maortic arch atherosclerosis 7 (mouse)182904910116904910Mouse
26884448Sklq1_mskull length QTL 1, 5 week (mouse)176000000181500000Mouse
10412238Alpq5_malcohol preference QTL 5 (mouse)Not determined182904910116904910Mouse
1302146Cocrb1_mcocaine related behavior 1 (mouse)Not determined170205811104211835Mouse
1301753Tir3a_mtrypansomiasis infection response 3a (mouse)Not determined197126256131126460Mouse
1357760Synch3_msynechia 3 (mouse)Not determined192973712126973820Mouse
10045976Tir6_mtrypanosome infection response 6 (mouse)Not determined193609133120601949Mouse
27095913Scvln2_msacral vertebrae length 2, 5 week (mouse)194200000148900000Mouse
1301304Hrq3_mheart rate quantitative locus 3 (mouse)Not determined173687970107688108Mouse
12879491Hfnq1_mhair follicle number QTL 1 (mouse)193382588123709030Mouse
4141347Reb1_mrepetitive behavior 1 (mouse)Not determined91540544100485942Mouse
27095931Pglq1_mpelvic girdle length QTL 1, 5 week (mouse)176000000128600000Mouse
1301350Nidd4k_mNidd4 on KK-A (mouse)Not determined782314261147249632Mouse
10412185Hcs9_mhepatocarcinogenesis susceptibility 9 (mouse)Not determined163815531189571420Mouse
27226779Tibl1_mtibia length 1, 5 week (mouse)195600000162200000Mouse
4141329Mleu1_mmyeloid leukemia survival 1 (mouse)Not determined89858782123858782Mouse
12790991Aath1_maortic arch atherosclerosis 1 (mouse)186556204120556204Mouse
11667074Led2_mlate embryonic death 2 (mouse)185768306117267351Mouse
13452395Leusq2_mleucocytosis susceptibility QTL 2 (mouse)180267876126458780Mouse
4141914Gcsfis_mG-CSF induced splenomegaly (mouse)Not determined74477076148839837Mouse
1357753Kidq2_mkidney weight QTL 2 (mouse)Not determined134721057150318120Mouse
1300841Ssial1_msusceptibility to sialadenitis 1 (mouse)Not determined163880843153681816Mouse
1357721Sle17_msystematic lupus erythematosus susceptibility 17 (mouse)Not determined139093727126517573Mouse
1301748Abbp1_mA/J and C57BL/6 blood pressure 1 (mouse)Not determined162907596120601949Mouse
4142291Aec2_mautoimmune exocrinopathy 2 (mouse)Not determined52418578182423027Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
1301099Cbm2_mcerebellum weight 2 (mouse)Not determined878518613112518703Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
10755519Wbc1_mwhite blood cell count 1 (mouse)881619151115619151Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904012Cfq10_mconditioned fear QTL 10 (mouse)88006677589014359Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1301766Desp1_mdespair 1 (mouse)Not determined884759576118759741Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse
1301581Char2_mP. chabaudi malaria resistance QTL 2 (mouse)Not determined879082178113082403Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
10755530Wbc2_mwhite blood cell count 2 (mouse)881092664115092664Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 21672 UniSTS
  241175 UniSTS
  383225 UniSTS
  633295 UniSTS
UniGene Mm.347009 UniSTS
  Mm.389169 UniSTS
UniSTS 163442 UniSTS