AA792894 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: AA792894

Symbol:

AA792894

Also known as:

318215;

RGD ID:

4956643

Expected Size:

84 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	6	71,284,996 - 71,285,079	UniSTS	GRCm38
MGSCv37	6	71,234,990 - 71,235,073	UniSTS	GRCm37
Celera	6	73,363,813 - 73,363,896	UniSTS
Cytogenetic Map	6	C1	UniSTS
Whitehead/MRC_RH	6	698.14	UniSTS

Is Marker For:

Genes: Krcc1

Annotation

References - curated


1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	TTCCACAAAAGCCATCAGTT
Reverse Primer	CCAAATTGCTGTGGTAGTGG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1315144	Krcc1	lysine-rich coiled-coil 1	6	71271677	71286825	Mouse

Nucleotide Sequences


RefSeq Transcripts	NM_145568	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AA792894	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC115777	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC160090	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC005704	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC046798	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC069863	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CR148674	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	GL597045	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
25440480	Moaq2_m	modifier of alien QTL 2 (mouse)					6	1	117500000	Mouse
26884414	Bzwq12_m	bi-zygomatic width QTL 12, 16 week (mouse)					6	3400000	139100000	Mouse
1300556	Cia6_m	collagen induced arthritis QTL 6 (mouse)			Not determined		6	4464884	87426034	Mouse
4142126	W3q3_m	weight 3 weeks QTL 3 (mouse)			Not determined			4503823	96656149	Mouse
4142361	W10q11_m	weight 10 weeks QTL 11 (mouse)			Not determined			4503823	96656149	Mouse
4142271	Egq8_m	early growth QTL 8 (mouse)			Not determined			4503823	96656149	Mouse
4142232	W6q4_m	weight 6 weeks QTL 4 (mouse)			Not determined			4503823	96656149	Mouse
26884441	Sklq3_m	skull length QTL 3, 5 week (mouse)					6	7600000	80600000	Mouse
1357442	Dbts1_m	diabetes 1 (mouse)			Not determined		6	18234148	73387692	Mouse
10412213	Sxbq2_m	SGC/Knj cross B6 QTL 2 (mouse)			Not determined		6	19912686	71322775	Mouse
13208564	Bmiq7_m	body mass index QTL 7 (mouse)					6	25000000	80000000	Mouse
4141782	Mrdq5_m	modifier of retinal degeneration QTL 5 (mouse)			Not determined			32850650	78238974	Mouse
1558984	Cplaq9_m	circadian period of locomotor activity 9 (mouse)			Not determined		6	38669625	92607450	Mouse
1301326	Trbv4c2_m	T cell receptor beta variable 4 (mouse)			Not determined		6	40891296	71379171	Mouse
12880424	V25Dq4_m	vitamin D inactive form serum level QTL 4 (mouse)					6	41600000	75600000	Mouse
1301266	Lmr4_m	leishmaniasis resistance 4 (mouse)			Not determined		6	42116373	76116515	Mouse
11040600	Lmr4c_m	leishmaniasis resistance 4c (mouse)					6	42116373	76116515	Mouse
11040601	Lmr4a_m	leishmaniasis resistance 4a (mouse)					6	42116373	76116515	Mouse
11533915	Mts4_m	mammary tumor susceptibility 4 (mouse)					6	42116373	76116515	Mouse
12910785	Pwgrq16_m	post-weaning growth rate QTL 16 (mouse)					6	43826813	77811523	Mouse
12910798	Pwgrq5_m	pre-weaning growth rate QTL 5 (mouse)					6	43826813	77811523	Mouse
12910802	Pwbwq12_m	post-weaning body weight QTL 12 (mouse)					6	43826813	77811523	Mouse
12910807	Pwbwq11_m	post-weaning body weight QTL 11 (mouse)					6	43826813	77811523	Mouse
12910809	Pwbwq10_m	post-weaning body weight QTL 10 (mouse)					6	43826813	77811523	Mouse
12910820	Ogrq3_m	overall growth rate QTL 3 (mouse)					6	43826813	77811523	Mouse
1300618	Pgia19_m	proteoglycan induced arthritis 19 (mouse)			Not determined		6	45314059	87426034	Mouse
10412157	Fl1n_m	fatty liver 1 in NSY (mouse)			Not determined		6	45314059	128835032	Mouse
4142259	Tabw2_m	tally ho associated body weight 2 (mouse)			Not determined			46935985	136423692	Mouse
25314319	Histh6_m	histamine hypersensitivity 6 (mouse)					6	48720000	125360000	Mouse
25314320	Histh5_m	histamine hypersensitivity 5 (mouse)					6	48720000	148450000	Mouse
4140983	Srilp_m	sleep response to influenza, light phase (mouse)			Not determined			48726556	75447710	Mouse
1301962	Eila2_m	ethanol induced locomotor activity 2 (mouse)			Not determined		6	48726556	125356785	Mouse
1301254	Skts11_m	skin tumor susceptibility 11 (mouse)			Not determined		6	51179150	85179300	Mouse
1357683	Igf1sl1_m	IGF-1 serum levels 1 (mouse)			Not determined		6	52161713	116155267	Mouse
4141028	Mclr_m	methylcholanthrene lymphoma resistance (mouse)			Not determined			54373427	88379171	Mouse
15039373	Adip28_m	adiposity 28 (mouse)					6	56308211	90308211	Mouse
15039375	Bw41_m	body weight QTL 41 (mouse)					6	56308211	90308211	Mouse
1558977	Skmw10_m	skeletal muscle weight 10 (mouse)			Not determined		6	58447583	92447710	Mouse
10043972	Obq28_m	obesity QTL 28 (mouse)			Not determined		6	58540433	92540433	Mouse
1301740	Bwq2_m	body weight QTL 2 (mouse)			Not determined		6	60057680	94057799	Mouse
1301369	Im4_m	immunoregulatory 4 (mouse)			Not determined		6	63484738	97484905	Mouse
1300650	Bw18_m	body weight QTL 18 (mouse)			Not determined		6	66713869	100714031	Mouse
1301876	Bits2_m	bitterness sensitivity 2 (mouse)			Not determined		6	70425898	104426034	Mouse
1301813	Skl3_m	skeletal size (tail length) 3 (mouse)			Not determined		6	70425898	104426034	Mouse
1301034	Egrm2_m	early growth rate (mouse)			Not determined		6	70425898	104426034	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	57896	UniSTS
UniSTS	163389	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description: