PMC124275P2 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: PMC124275P2

Symbol: PMC124275P2
Also known as:
RGD ID: 4952601
Expected Size: 500 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38954,824,219 - 54,824,723UniSTSGRCm38
GRCm38687,999,999 - 88,000,498UniSTSGRCm38
MGSCv37954,672,026 - 54,672,530UniSTSGRCm37
MGSCv37687,949,993 - 87,950,492UniSTSGRCm37
Celera689,936,925 - 89,937,424UniSTS
Celera952,068,641 - 52,069,145UniSTS
Cytogenetic Map9BUniSTS
Cytogenetic Map6D1UniSTS
cM Map932.0UniSTS
cM Map638.5UniSTS
Is Marker For: Genes:   Rab7   Rab7-ps1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAACCCATCAAACTGGACA
Reverse Primer CAAGGAGGGAGGGGTAAAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
62201Rab7RAB7, member RAS oncogene family68799910688045270Mouse
9662917Gm30935predicted gene, 3093595482346654824260Mouse
1615170Rab7-ps1RAB7, member RAS oncogene family, pseudogene 195482446054825362Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
12904939Edlmmq8_mextensor digitorum longus muscle mass QTL 8 (mouse)92094144454941444Mouse
13208563Bmiq8_mbody mass index QTL 8 (mouse)92500000069000000Mouse
11532694Sluc39a_msusceptibility to lung cancer 39a (mouse)92567618959676285Mouse
11532695Sluc39b_msusceptibility to lung cancer 39b (mouse)92567618959676285Mouse
11532696Sluc39c_msusceptibility to lung cancer 39c (mouse)92567618959676285Mouse
11532712Sluc39d_msusceptibility to lung cancer 39d (mouse)92567618959676285Mouse
1300932Hdlq17_mHDL QTL 17 (mouse)Not determined92688512460885255Mouse
10043867Mtbcq9_mmultiple trait body composition QTL 9 (mouse)Not determined92688512460885255Mouse
10043987Stheal13_msoft tissue heal 13 (mouse)Not determined92688512460885255Mouse
10043878Adip20_madiposity 20 (mouse)Not determined92733989761340026Mouse
10043847Hdlq89_mHDL QTL 89 (mouse)Not determined92938163163381774Mouse
1301782Chol11_mcholesterol 11 (mouse)Not determined92938163163381774Mouse
1301365Ap5q_malcohol preference 5 QTL (mouse)Not determined93014186664141979Mouse
1357746Vtbt7_mvertebral trabecular bone trait 7 (mouse)Not determined93082861764828723Mouse
1302180Actd4_mactivity-distance traveled 4 (mouse)Not determined93252326366523557Mouse
4141148Cq5_mcholesterol QTL 5 (mouse)Not determined93254112166541246Mouse
1301692Hts_mhypothermia sensitivity (mouse)Not determined93259987266600121Mouse
4141323Ptnu3_mproteinuria 3 (mouse)Not determined93297840266978536Mouse
1357709Si5lq3_mserum IGFBP-5 level QTL 3 (mouse)Not determined93319972567199840Mouse
1558872Ibdq1_minflammatory bowel disease QTL 1 (mouse)Not determined93406754473531973Mouse
1301252Etohc3_methanol consumption 3 (mouse)Not determined93512317869123299Mouse
1301972Cocrb8_mcocaine related behavior 8 (mouse)Not determined93512317869123299Mouse
1558968Tbdr1_mbody temperature response to dietary restriction, QTL 1 (mouse)Not determined93512317869123299Mouse
4142042Alpq3_malcohol preference QTL 3 (mouse)Not determined93739490198819654Mouse
10043971Obq32_mobesity QTL 32 (mouse)Not determined93791224471912244Mouse
12791002Arlsq2_maortic root lesion size QTL 2 (mouse)93819229172192291Mouse
12790986Pcho9_mplasma cholesterol 9 (mouse)93819229172192291Mouse
12790992Arlsq1_maortic root lesion size QTL 1 (mouse)93819229172192291Mouse
12738449Spcq2_msperm count QTL 2 (mouse)93949260173492601Mouse
4141071Ath29_matherosclerosis 29 (mouse)Not determined94050829874700643Mouse
1301702Brm1_mbrachyury modifier 1 (mouse)Not determined94089776474897921Mouse
1301558Stheal8_msoft tissue heal 8 (mouse)Not determined94357343177573577Mouse
10045639Heal28_mwound healing/regeneration 28 (mouse)Not determined94357343177573577Mouse
1301435Trigq1_mtriglyceride QTL 1 (mouse)Not determined94452089278520980Mouse
4141572Ntta3_mneurotensin transcript abundance 3 (mouse)Not determined4668637365923895Mouse
4141754Fecq4_mfecundity QTL 4 (mouse)Not determined94763172657897921Mouse
1300716Cd4ts4_mCD4 T cell subset 4 (mouse)Not determined94892377482923895Mouse
1300563Pgia5_mproteoglycan induced arthritis 5 (mouse)Not determined94892377482923895Mouse
1301051Eae9_msusceptibility to experimental allergic encephalomyelitis 9 (mouse)Not determined94950899863332570Mouse
1301049El4_mepilepsy 4 (mouse)Not determined94950899867244166Mouse
4141224Dxmod_mdoxorubicin nephropathy modifier (mouse)Not determined49541121101528921Mouse
14746993Manh66_mmandible shape 66 (mouse)94990676683906766Mouse
1301184Bdln4_mbody length 4 (mouse)Not determined95024403884244166Mouse
1301241Renf1_mrenal failure 1 (mouse)Not determined95212317899910428Mouse
13525008Hrtiq1_mheart rate time index, QTL 1 (mouse)95251479868648726Mouse
12790990Tgl7_mtriglyceride 7 (mouse)95465267888652678Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 19349 UniSTS
  19350 UniSTS
UniSTS 270460 UniSTS