UniSTS:236299 Marker Search Result

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

General

Marker: UniSTS:236299

Symbol:

UniSTS:236299

Also known as:

Expected Size:

237 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	10	4,857,066 - 4,857,302	UniSTS	GRCm38
MGSCv37	10	5,489,239 - 5,489,475	UniSTS	GRCm37
Celera	10	4,799,538 - 4,799,774	UniSTS
Cytogenetic Map	10	A1	UniSTS
cM Map	10	12.0	UniSTS

Is Marker For:

Genes: Esr1

Annotation

References - curated

1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	AGCCATCTCCCTAATCCCAT
Reverse Primer	ACCGCCCATGATCTATTCTG

Region

Genes in Region (GRCm38)

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
10551	Esr1	estrogen receptor 1 (alpha)	10	4611989	5005633	Mouse

Nucleotide Sequences

GenBank Nucleotide	AB560753	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC153573	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300881	Sluc29_m	susceptibility to lung cancer 29 (mouse)			Not determined		10	1	26413521	Mouse
1300759	Geot_m	geotaxia (mouse)			Not determined		10	1	26413521	Mouse
11532717	Sluc44g_m	susceptibility to lung cancer 44g (mouse)					10	1	26413521	Mouse
11532718	Sluc44f_m	susceptibility to lung cancer 44f (mouse)					10	1	26413521	Mouse
11532720	Sluc44a_m	susceptibility to lung cancer 44a (mouse)					10	1	26413521	Mouse
11532721	Sluc44_m	susceptibility to lung cancer 44 (mouse)					10	1	26413521	Mouse
11532722	Sluc44e_m	susceptibility to lung cancer 44e (mouse)					10	1	26413521	Mouse
11532723	Sluc44d_m	susceptibility to lung cancer 44d (mouse)					10	1	26413521	Mouse
11532724	Sluc44c_m	susceptibility to lung cancer 44c (mouse)					10	1	26413521	Mouse
11532725	Sluc44b_m	susceptibility to lung cancer 44b (mouse)					10	1	26413521	Mouse
11533917	Mts2_m	mammary tumor susceptibility 2 (mouse)					10	1	26413521	Mouse
12879494	Facq1_m	fear acquisition QTL 1 (mouse)					10	1	31403386	Mouse
1357813	Ath20_m	atherosclerosis 20 (mouse)			Not determined		10	3407439	37407588	Mouse
1300790	Pgia6_m	proteoglycan induced arthritis 6 (mouse)			Not determined		10	3934272	37934396	Mouse
1300997	Eae15_m	susceptibility to experimental allergic encephalomyelitis 15 (mouse)			Not determined		10	4532255	38532377	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	13982	UniSTS
UniGene	Mm.9213	UniSTS
UniSTS	236299	UniSTS

More on UniSTS:236299
	JBrowse: mm9 mm10
	Ensembl
	NCBI

RGD Object Information
RGD ID:	4948098
Created:	2011-03-01
Species:	Mus musculus
Last Modified:	2014-08-05
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.