UniSTS:235933 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:235933

Symbol: UniSTS:235933
Also known as:
RGD ID: 4947473
Expected Size: 261 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38877,664,302 - 77,664,562UniSTSGRCm38
MGSCv37880,188,201 - 80,188,461UniSTSGRCm37
Celera881,947,729 - 81,947,989UniSTS
Cytogenetic Map8C2UniSTS
Is Marker For: Genes:   Ednra  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGCAGCCCCTTAATACAG
Reverse Primer GCTAACCTTGAACACCTGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
737538Ednraendothelin receptor type A87766302977724452Mouse
16122324933431K23RikRIKEN cDNA 4933431K23 gene87763594177667101Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 13617 UniSTS
UniGene Mm.283168 UniSTS
UniSTS 235933 UniSTS