UniSTS:235906 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:235906

Symbol: UniSTS:235906
Also known as:
RGD ID: 4947429
Expected Size: 114 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381128,331,905 - 128,332,018UniSTSGRCm38
GRCm38868,620,354 - 68,620,467UniSTSGRCm38
MGSCv371130,228,482 - 130,228,595UniSTSGRCm37
MGSCv37871,144,253 - 71,144,366UniSTSGRCm37
Celera871,164,001 - 71,164,114UniSTS
Celera1130,958,786 - 130,958,899UniSTS
Cytogenetic Map8B3.3UniSTS
Cytogenetic Map1E4UniSTS
cM Map166.6UniSTS
Is Marker For: Genes:   Mcm6   Csgalnact1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGAAAGGCTCCAGTGAAGG
Reverse Primer GTCCCTGGCCATCAAGTTAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
62260Mcm6minichromosome maintenance complex component 61128331575128359705Mouse
1316918Csgalnact1chondroitin sulfate N-acetylgalactosaminyltransferase 186835678168735621Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13824984Twq5_mtestis weight QTL 5 (mouse)13000000185000000Mouse
1357753Kidq2_mkidney weight QTL 2 (mouse)Not determined134721057150318120Mouse
1357488Splq3_mspleen weight QTL 3 (mouse)Not determined134721057150318120Mouse
1558860W10q7_mweight 10 weeks QTL 7 (mouse)Not determined134721057150318120Mouse
1301722Cia9_mcollagen induced arthritis QTL 9 (mouse)Not determined145744740189571420Mouse
4142291Aec2_mautoimmune exocrinopathy 2 (mouse)Not determined52418578182423027Mouse
10412185Hcs9_mhepatocarcinogenesis susceptibility 9 (mouse)Not determined163815531189571420Mouse
1300841Ssial1_msusceptibility to sialadenitis 1 (mouse)Not determined163880843153681816Mouse
27095918Ulnl1_mulna length 1, 5 week (mouse)167300000129800000Mouse
1300989Lrdg1_mlight induced retinal degeneration 1 (mouse)Not determined173716016147249632Mouse
4141914Gcsfis_mG-CSF induced splenomegaly (mouse)Not determined74477076148839837Mouse
1357847Jckm2_mjuvenile cystic kidney modifier 2 (mouse)Not determined174952818133363199Mouse
27095931Pglq1_mpelvic girdle length QTL 1, 5 week (mouse)176000000128600000Mouse
27095928Pglq6_mpelvic girdle length QTL 6, 10 week (mouse)176000000148900000Mouse
26884448Sklq1_mskull length QTL 1, 5 week (mouse)176000000181500000Mouse
1301350Nidd4k_mNidd4 on KK-A (mouse)Not determined782314261147249632Mouse
1357439Popoa_mpremature ovulation and primary oocyte arrest (mouse)Not determined182665468135687641Mouse
27095913Scvln2_msacral vertebrae length 2, 5 week (mouse)194200000148900000Mouse
27095901Scvln8_msacral vertebrae length 2, 10 week (mouse)194200000172200000Mouse
27226779Tibl1_mtibia length 1, 5 week (mouse)195600000162200000Mouse
1301123Cd8mts2_mCD8 memory T cell subset 2 (mouse)Not determined196690656130690827Mouse
1301753Tir3a_mtrypansomiasis infection response 3a (mouse)Not determined197126256131126460Mouse
1301536Pbbcp1_mperipheral blood B cell percentage 1 (mouse)Not determined199579930133580115Mouse
1301193Lxw3_mlupus BXSB x NZW 3 (mouse)Not determined1103040804137040937Mouse
10412162Nobq3_mNew Zealand obese QTL 3 (mouse)Not determined1104005680191493284Mouse
12790994Aaaq1_maortic arch angle QTL 1 (mouse)1109568206143568206Mouse
1301979Melm1_mmelanoma modifier 1 (mouse)Not determined1109710525143710742Mouse
1357600Obq17_mobesity QTL 17 (mouse)Not determined1110625442144625561Mouse
10401248Bglu12_mblood glucose level 12 (mouse)Not determined1110625442144625561Mouse
1301149Lrnx12_mlearning-contextual 12 (mouse)Not determined1112081092168358833Mouse
1302098Eila1_methanol induced locomotor activity 1 (mouse)Not determined1112081092175641372Mouse
1301249Sbw1_msplenomegaly-NZB x NZW 1 (mouse)Not determined1112203268146203348Mouse
10045640Jckm4_mjuvenile cystic kidney modifier 4 (mouse)Not determined1116363098150363199Mouse
27095915Scvln13_msacral vertebrae length 2, 16 week (mouse)1117600000180000000Mouse
1302161Exq2_mexploratory and excitability QTL 2 (mouse)Not determined1118171982152172078Mouse
27226714Metcl1_mmetatarsal-calcaneal length 1, 5 week (mouse)1121800000139800000Mouse
27226740Metcl13_mmetatarsal-calcaneal length 13, 16 week (mouse)1121800000153900000Mouse
27226743Metcl7_mmetatarsal-calcaneal length 7, 10 week (mouse)1121800000154000000Mouse
27226767Tibl10_mtibia length 10, 10 week (mouse)1121800000165000000Mouse
27226799Feml5_mfemur length 5, 5 week (mouse)1122100000165000000Mouse
12880408V125Dq3_mvitamin D active form serum level QTL 3 (mouse)1123000000157000000Mouse
1558870Eae36_mexperimental allergic encephalomyelitis susceptibility 36 (mouse)Not determined81472316071045600Mouse
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 17219 UniSTS
  234356 UniSTS
UniSTS 235906 UniSTS