UniSTS:234959 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:234959

Symbol: UniSTS:234959
Also known as:
RGD ID: 4945817
Expected Size: 233 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38487,581,741 - 87,581,974UniSTSGRCm38
GRCm38683,808,420 - 83,808,652UniSTSGRCm38
MGSCv37683,758,414 - 83,758,646UniSTSGRCm37
MGSCv37487,227,645 - 87,227,878UniSTSGRCm37
Celera685,791,379 - 85,791,611UniSTS
Celera486,106,724 - 86,106,957UniSTS
Cytogenetic Map6C3UniSTS
Is Marker For: Genes:   Paip2b  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAGCATGGCTCTTCTGTTG
Reverse Primer ACCCAGCTGCAAACTCCTTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
15018567Gm52908predicted gene, 5290868380492483811805Mouse
1317410Paip2bpoly(A) binding protein interacting protein 2B68380605883831741Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
4141990Etax6_methanol induced ataxia 6 (mouse)Not determined7132262186275719Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11567249Elorr3_methanol induced loss of righting response 3 (mouse)43722677156183778Mouse
4142047Mvwf3_mmodifier of von Willebrand factor 3 (mouse)Not determined14010457117215009Mouse
4141911W6q15_mweight 6 weeks QTL 15 (mouse)Not determined1789261689063979Mouse
1357645Lvrq9_mliver weight QTL 9 (mouse)Not determined41789261689063979Mouse
1357453Kidq4_mkidney weight QTL 4 (mouse)Not determined41789261689063979Mouse
39128211Lwq22_mliver weight QTL 22 (mouse)41789261689063979Mouse
26884449Sklq2_mskull length QTL 2, 5 week (mouse)436700000129100000Mouse
27226724Tibw2_mtibia width 2, proximal, 10 week (mouse)443000000108500000Mouse
1558948Ath8_matherosclerosis 8 (mouse)Not determined445658442105299798Mouse
1357895Ctrcts_mcataract severity (mouse)Not determined445709925138615442Mouse
1300966Pabr2_mplasma apolipoprotein B (human) regulator 2 (mouse)Not determined446332646105944663Mouse
11532714Sluc43_msusceptibility to lung cancer 43 (mouse)446642108123233418Mouse
13207572Spir2_mStreptococcus pneumoniae infection resistance 2 (mouse)45068279588592400Mouse
1301033Abbp2_mA/J and C57BL/6 blood pressure 2 (mouse)Not determined45355083993875068Mouse
4141900Skts-fp1_mskin tumor susceptibility in FVB and PWK 1 (mouse)Not determined453550839124161387Mouse
26884434Zlq1_mzygomatic length QTL 1, 5 week (mouse)453700000103400000Mouse
13524838Hbasrq1a_mhabituation of the acoustic startle response QTL 1a (mouse)45455335288553352Mouse
13524841Hbasrq1_mhabituation of the acoustic startle response QTL 1 (mouse)45455335288553352Mouse
27095905Scvln3_msacral vertebrae length 2, 5 week (mouse)455600000129100000Mouse
27095934Ulnl2_mulna length 2, 5 week (mouse)45770000094900000Mouse
26884437Sklq13_mskull length QTL 13, 16 week (mouse)457700000155600000Mouse
10043964Obq26_mobesity QTL 26 (mouse)Not determined45912901493129014Mouse
1301190Cd4ts2_mCD4 T cell subset 2 (mouse)Not determined46022704094227187Mouse
1357507Synch2_msynechia 2 (mouse)Not determined46022704094227187Mouse
1357870Pfat1_mpredicted fat percentage 1 (mouse)Not determined46370128997701448Mouse
12879903Berr8_mberghei resistance locus 8 (mouse)46430422398304223Mouse
27095939Ulnl9_mulna length 9, 16 week (mouse)465400000119000000Mouse
13506251Cytrq1_mcytokine response QTL 1 (mouse)46579984999799849Mouse
25314312Syncl2_msynaptonemal complex length 2 (mouse)465800000146500000Mouse
27095938Ulnl6_mulna length 6, 10 week (mouse)46680000098700000Mouse
1301757Tlsr4_mthymic lymphoma suppressor region 4 (mouse)Not determined466838893100839021Mouse
1357561Mbsyd_mmetabolic syndrome (mouse)Not determined466970208100970351Mouse
27095900Scvln9_msacral vertebrae length 2, 10 week (mouse)468100000107300000Mouse
27095917Scvln14_msacral vertebrae length 2, 16 week (mouse)468100000130500000Mouse
26884445Sklq7_mskull length QTL 7, 10 week (mouse)468100000150800000Mouse
27095924Pglq2_mpelvic girdle length QTL 2, 5 week (mouse)469200000131000000Mouse
1302057Pgia27_mproteoglycan induced arthritis 27 (mouse)Not determined470148990104149227Mouse
1301739Pitm2_mprion incubation time 2 (mouse)Not determined472063832106063979Mouse
1302044Nss1_mNOD Sjogren's syndrome 1 (mouse)Not determined472063832106063979Mouse
12879897Berr4_mberghei resistance locus 4 (mouse)472063832106063979Mouse
1302031Bulb1_mbulb size 1 (mouse)Not determined474145650108145792Mouse
1301597Anxty_manxiety (mouse)Not determined474219337128115487Mouse
10412193Plep_mplasma lepin levels (mouse)Not determined474556462108556746Mouse
11532700Sluc43d_msusceptibility to lung cancer 43d (mouse)474556462108556746Mouse
11532701Sluc43e_msusceptibility to lung cancer 43e (mouse)474556462108556746Mouse
11532702Sluc43f_msusceptibility to lung cancer 43f (mouse)474556462108556746Mouse
11532703Sluc43g_msusceptibility to lung cancer 43g (mouse)474556462108556746Mouse
11532704Sluc43a_msusceptibility to lung cancer 43a (mouse)474556462108556746Mouse
11532705Sluc43b_msusceptibility to lung cancer 43b (mouse)474556462108556746Mouse
11532706Sluc43c_msusceptibility to lung cancer 43c (mouse)474556462108556746Mouse
11532707Sluc43h_msusceptibility to lung cancer 43h (mouse)474556462108556746Mouse
11532708Sluc43i_msusceptibility to lung cancer 43i (mouse)474556462108556746Mouse
26884431Zlq8_mzygomatic length QTL 8, 16 week (mouse)474800000108500000Mouse
26884406Huml3_mhumerus length 3, 10 week (mouse)475700000100300000Mouse
1301545Gauc_mglucose area under curve (mouse)Not determined476874870110875068Mouse
1300697Sle2_msystemic lupus erythmatosus susceptibility 2 (mouse)Not determined478069342112069538Mouse
11039504Ltpr4a_mLeishmania tropica response 4a (mouse)479477514113477630Mouse
11039505Ltpr4c_mLeishmania tropica response 4c (mouse)479477514113477630Mouse
11039506Ltpr4b_mLeishmania tropica response 4b (mouse)479477514113477630Mouse
11039517Ltpr4_mLeishmania tropica response 4 (mouse)479477514113477630Mouse
4142203Lyr_mlymphoma resistance (mouse)Not determined8083420888850951Mouse
12904738Idohtq_miris defect with ocular hypertension QTL (mouse)48083423093224754Mouse
12904933Edlmmq3_mextensor digitorum longus muscle mass QTL 3 (mouse)481325754115325754Mouse
1302204Spm1_msplenomegaly modifier (mouse)Not determined482356158116356345Mouse
27095921Pglq12_mpelvic girdle length QTL 12, 16 week (mouse)483200000108500000Mouse
1301867Idd11_minsulin dependent diabetes susceptibility 11 (mouse)Not determined483747673117747809Mouse
10412176Habiir3_mhyperoxic acute lung injury imprinted region 3 (mouse)Not determined48383889394405503Mouse
27226787Feml14_mfemur length 14, 10 week (mouse)485000000107300000Mouse
26884435Zlq4_mzygomatic length QTL 4, 10 week (mouse)485200000105100000Mouse
1301556Cd4vts1_mCD4 virgin T cell subset 1 (mouse)Not determined485571641119571840Mouse
1357726Lnopy1_mlens opacity 1 (mouse)Not determined485571641119571840Mouse
1301930Papg1_mpulmonary adenoma progression 1 (mouse)Not determined485923970119924082Mouse
1301118Bbaa23_mB.burgdorferi-associated arthritis 23 (mouse)Not determined485923970119924082Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 232164 UniSTS
UniSTS 234959 UniSTS