Lrig1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Lrig1

Symbol: Lrig1
Also known as:
RGD ID: 4941657
Expected Size: 528 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38694,605,760 - 94,607,314UniSTSGRCm38
MGSCv37694,555,754 - 94,557,308UniSTSGRCm37
Celera696,506,250 - 96,507,737UniSTS
Cytogenetic Map6D2UniSTS
cM Map639.0UniSTS
Is Marker For: Genes:   Lrig1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GACAGCTGCCCCACATACAA
Reverse Primer TAGCTTCTCGGTGCCAATAG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3723704 UniSTS
  MGI:4411409 UniSTS
NCBI Gene 16206 UniSTS
UniSTS 507035 UniSTS