RH125881 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH125881

Symbol: RH125881
Also known as:
RGD ID: 4939191
Expected Size: 166 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389123,307,218 - 123,307,383UniSTSGRCm38
GRCm384108,044,460 - 108,044,625UniSTSGRCm38
MGSCv374107,717,065 - 107,717,230UniSTSGRCm37
MGSCv379123,216,336 - 123,216,501UniSTSGRCm37
Celera9123,759,670 - 123,759,835UniSTS
Celera4106,394,083 - 106,394,248UniSTS
Cytogenetic Map9F4UniSTS
Cytogenetic Map4C7UniSTS
cM Map970.5UniSTS
cM Map452.0UniSTS
Is Marker For: Genes:   Scp2   Scp2-ps2   Gm19491  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGATTTTACTGTTCTGAATTT
Reverse Primer GGTGTGGTCAATTGTGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11273Scp2sterol carrier protein 2, liver4108043830108144971Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse
11567249Elorr3_methanol induced loss of righting response 3 (mouse)43722677156183778Mouse
4142047Mvwf3_mmodifier of von Willebrand factor 3 (mouse)Not determined14010457117215009Mouse
26884449Sklq2_mskull length QTL 2, 5 week (mouse)436700000129100000Mouse
27226724Tibw2_mtibia width 2, proximal, 10 week (mouse)443000000108500000Mouse
1357895Ctrcts_mcataract severity (mouse)Not determined445709925138615442Mouse
11532714Sluc43_msusceptibility to lung cancer 43 (mouse)446642108123233418Mouse
4141900Skts-fp1_mskin tumor susceptibility in FVB and PWK 1 (mouse)Not determined453550839124161387Mouse
27095905Scvln3_msacral vertebrae length 2, 5 week (mouse)455600000129100000Mouse
26884437Sklq13_mskull length QTL 13, 16 week (mouse)457700000155600000Mouse
27095939Ulnl9_mulna length 9, 16 week (mouse)465400000119000000Mouse
25314312Syncl2_msynaptonemal complex length 2 (mouse)465800000146500000Mouse
27095917Scvln14_msacral vertebrae length 2, 16 week (mouse)468100000130500000Mouse
26884445Sklq7_mskull length QTL 7, 10 week (mouse)468100000150800000Mouse
27095924Pglq2_mpelvic girdle length QTL 2, 5 week (mouse)469200000131000000Mouse
1302031Bulb1_mbulb size 1 (mouse)Not determined474145650108145792Mouse
1301597Anxty_manxiety (mouse)Not determined474219337128115487Mouse
10412193Plep_mplasma lepin levels (mouse)Not determined474556462108556746Mouse
11532700Sluc43d_msusceptibility to lung cancer 43d (mouse)474556462108556746Mouse
11532701Sluc43e_msusceptibility to lung cancer 43e (mouse)474556462108556746Mouse
11532702Sluc43f_msusceptibility to lung cancer 43f (mouse)474556462108556746Mouse
11532703Sluc43g_msusceptibility to lung cancer 43g (mouse)474556462108556746Mouse
11532704Sluc43a_msusceptibility to lung cancer 43a (mouse)474556462108556746Mouse
11532705Sluc43b_msusceptibility to lung cancer 43b (mouse)474556462108556746Mouse
11532706Sluc43c_msusceptibility to lung cancer 43c (mouse)474556462108556746Mouse
11532707Sluc43h_msusceptibility to lung cancer 43h (mouse)474556462108556746Mouse
11532708Sluc43i_msusceptibility to lung cancer 43i (mouse)474556462108556746Mouse
26884431Zlq8_mzygomatic length QTL 8, 16 week (mouse)474800000108500000Mouse
1301545Gauc_mglucose area under curve (mouse)Not determined476874870110875068Mouse
1300697Sle2_msystemic lupus erythmatosus susceptibility 2 (mouse)Not determined478069342112069538Mouse
11039504Ltpr4a_mLeishmania tropica response 4a (mouse)479477514113477630Mouse
11039505Ltpr4c_mLeishmania tropica response 4c (mouse)479477514113477630Mouse
11039506Ltpr4b_mLeishmania tropica response 4b (mouse)479477514113477630Mouse
11039517Ltpr4_mLeishmania tropica response 4 (mouse)479477514113477630Mouse
12904933Edlmmq3_mextensor digitorum longus muscle mass QTL 3 (mouse)481325754115325754Mouse
1302204Spm1_msplenomegaly modifier (mouse)Not determined482356158116356345Mouse
27095921Pglq12_mpelvic girdle length QTL 12, 16 week (mouse)483200000108500000Mouse
1301867Idd11_minsulin dependent diabetes susceptibility 11 (mouse)Not determined483747673117747809Mouse
1301556Cd4vts1_mCD4 virgin T cell subset 1 (mouse)Not determined485571641119571840Mouse
1357726Lnopy1_mlens opacity 1 (mouse)Not determined485571641119571840Mouse
1301930Papg1_mpulmonary adenoma progression 1 (mouse)Not determined485923970119924082Mouse
1301118Bbaa23_mB.burgdorferi-associated arthritis 23 (mouse)Not determined485923970119924082Mouse
27226739Metcl14_mmetatarsal-calcaneal length 14, 16 week (mouse)487600000108500000Mouse
27095927Pglq7_mpelvic girdle length QTL 7, 10 week (mouse)488200000108500000Mouse
27226716Metcl2_mmetatarsal-calcaneal length 2, 5 week (mouse)488200000118700000Mouse
27226770Tibl11_mtibia length 11, 10 week (mouse)488600000108500000Mouse
27226766Tibl17_mtibia length 17, 16 week (mouse)488600000108600000Mouse
11532738Abd1_mautoimmune biliary disease 1 (mouse)489063832116413923Mouse
4141549W10q10_mweight 10 weeks QTL 10 (mouse)Not determined89063832140740892Mouse
4141093W3q17_mweight 3 weeks QTL 17 (mouse)Not determined89063832140740892Mouse
4141623W6q13_mweight 6 weeks QTL 13 (mouse)Not determined89063832140740892Mouse
1357529Lvrq8_mliver weight QTL 8 (mouse)Not determined489063832140740892Mouse
39128212Lwq21_mliver weight QTL 21 (mouse)489063832140740892Mouse
1301823Bmd7_mbone mineral density 7 (mouse)Not determined489063832151570093Mouse
13824982Svwq1_mseminal vesicle weight QTL 1 (mouse)490000000119000000Mouse
1300918Stheal4_msoft tissue heal 4 (mouse)Not determined490112430124112550Mouse
11553870Cmmm_mcarcinoma modifier of MSM (mouse)490733471124733584Mouse
27226760Feml19_mfemur length 19, 16 week (mouse)491000000108600000Mouse
27226782Tibl2_mtibia length 2, 5 week (mouse)491000000111400000Mouse
13208562Wght7_mweight 7 (mouse)491000000148000000Mouse
15039368Nmrs19_mNAFLD-associated magnetic resonance shift 19 (mouse)491025583125025583Mouse
12904002Opfaq9_mopen field activity QTL 9 (mouse)493118593127118593Mouse
1301731Cafq2_mcaffeine metabolism QTL 2 (mouse)Not determined494875058128875257Mouse
1301233Sbw2_msplenomegaly-NZB x NZW 2 (mouse)Not determined495069342128115487Mouse
1301815Sles2_msystemic lupus erythmatosus suppressor 2 (mouse)Not determined495069342150592401Mouse
14696687Gdq1_mgrooming duration QTL 1, males (mouse)497000000112000000Mouse
1300580Lbw2_mlupus NZB x NZW 2 (mouse)Not determined498657302128115487Mouse
1301106Skts7_mskin tumor susceptibility 7 (mouse)Not determined4100214774134215009Mouse
1301847Fecq2_mfecundity QTL 2 (mouse)Not determined4100214774134215009Mouse
14696689Gdq2_mgrooming duration QTL 2, females (mouse)4101000000125000000Mouse
12880433Fgf23lq1_mFGF23 serum level QTL 1 (mouse)4101300000135300000Mouse
1300689Dob1_mDietary obesity 1 (mouse)Body weight4101717404123233418Mouse
15039377Bw45_mbody weight QTL 45 (mouse)4105812001139812001Mouse
15039378Adip30_madiposity 30 (mouse)4105812001139812001Mouse
15039382Ltgq7_mliver triglyceride QTL 7 (mouse)4105812001139812001Mouse
12910794Pwbwq8_mpost-weaning body weight QTL 8 (mouse)4105978113141706527Mouse
12910797Pwgrq4_mpre-weaning growth rate QTL 4 (mouse)4105978113141706527Mouse
12910808Pwbwq9_mpost-weaning body weight QTL 9 (mouse)4105978113141706527Mouse
12910813Pwbwq4_mpre-weaning body weight QTL 4 (mouse)4105978113141706527Mouse
1357800Tgq3_mtriglyceride QTL 3 (mouse)Not determined4107161300141161387Mouse
1300663Start2_mstartle response 2 (mouse)Not determined4107371164141371360Mouse
1300809Ccrs2_mcorpus callosum hemisphere surface size 2 (mouse)Not determined4107371164141371360Mouse
1300781Lith8_mlithogenic gene 8 (mouse)Not determined4107371164141371360Mouse
1301382Arvm2_mautoimmune renal vasculitis 2 (mouse)Not determined4107897771141897963Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100502992 UniSTS
  20280 UniSTS
  20282 UniSTS
UniSTS 162613 UniSTS