RH125419 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH125419

Symbol: RH125419
Also known as:
RGD ID: 4938453
Expected Size: 197 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm3811115,657,228 - 115,657,424UniSTSGRCm38
GRCm38683,199,878 - 83,200,074UniSTSGRCm38
MGSCv37683,149,872 - 83,150,068UniSTSGRCm37
MGSCv3711115,518,542 - 115,518,738UniSTSGRCm37
Celera11127,425,476 - 127,425,672UniSTS
Celera685,182,822 - 85,183,018UniSTS
Cytogenetic Map11E2UniSTS
Cytogenetic Map6C3UniSTS
cM Map1175.0UniSTS
cM Map634.9UniSTS
Is Marker For: Genes:   Dctn1   Grb2   Gm11702  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGGACCACACGCTAACCT
Reverse Primer GGGAGACCTCACTCAATCTTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
732474Grb2growth factor receptor bound protein 211115644045115708597Mouse
5146253Gm11702predicted gene 1170211115657169115660777Mouse
62330Dctn1dynactin 168316590983200118Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
1300649Crhq1_mcompensatory renal hypertrophy QTL 1 (mouse)Not determined1181683655115683810Mouse
1300766Skull16_mskull morphology 16 (mouse)Not determined1181683655115683810Mouse
10412288Carg4_mCandida albicans resistance gene 4 (mouse)Not determined1181919441115919441Mouse
1301072Eae22_mexperimental allergic encephalomyelitis 22 (mouse)Not determined1182486872116486994Mouse
14747003Mancz9_mmandible centroid size 9 (mouse)1185954085119954085Mouse
15039374Adip29_madiposity 29 (mouse)1186717494120717494Mouse
15039376Bw42_mbody weight QTL 42 (mouse)1186717494120717494Mouse
15014785Mvlq1_mmacrovesicular liver lesion QTL 1 (mouse)1186717494120717494Mouse
27226789Feml16_mfemur length 16, 10 week (mouse)1187600000126900000Mouse
10044007Hbnr14_mHeligmosomoides bakeri nematode resistance 14 (mouse)Not determined1187611774121611872Mouse
11251723Ewc5_methanol withdrawal and consumption 5 (mouse)1189978425122082543Mouse
1302034Pkccl_mprotein kinase C content in lungs (mouse)Not determined1191713782122082543Mouse
1558753Ath19_matherosclerosis 19 (mouse)Not determined1191713782122082543Mouse
1301095El6_mepilepsy 6 (mouse)Not determined1193338357122082543Mouse
4141939Pregq2_mpregnancy QTL 2 (mouse)Not determined1194172953118131898Mouse
27226731Tibmd4_mtibia midshaft diameter 4, 10 week (mouse)1194300000119000000Mouse
4141465Dbm2_mdiabetes modifier 2 (mouse)Not determined94546357118131898Mouse
1300944Alcp20_malcohol preference locus 20 (mouse)Not determined1195513139122082543Mouse
1301958Alcp18_malcohol preference locus 18 (mouse)Not determined1195513139122082543Mouse
1300962Cd8mts4_mCD8 memory T cell subset 4 (mouse)Not determined1196246848122082543Mouse
1301057Nidd4_mnon-insulin-dependent diabetes mellitus 4 (mouse)Not determined1196919310122082543Mouse
1301983Berr2_mberghei resistance locus 2 (mouse)Not determined1198461783122082543Mouse
10043976Obq33_mobesity QTL 33 (mouse)Not determined1198609643122082543Mouse
10044001Alcw8_malcohol withdrawal 8 (mouse)Not determined1199363361122082543Mouse
11553867Stmm5_mskin tumor modifier of MSM 5 (mouse)11100167277122082543Mouse
11341721Rvfs2_mRift Valley fever susceptibility 2 (mouse)11100363360120996339Mouse
1301012Vispl_mvisual placing (mouse)Not determined11101131764122082543Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
4141990Etax6_methanol induced ataxia 6 (mouse)Not determined7132262186275719Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
14697704Stsl4_mSalmonella typhimurium susceptibility locus 4 (mouse)67710000090000000Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100503586 UniSTS
  13191 UniSTS
  14784 UniSTS
UniSTS 162241 UniSTS