RH124790 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH124790

Symbol: RH124790
Also known as:
RGD ID: 4937202
Expected Size: 164 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389121,747,982 - 121,748,145UniSTSGRCm38
MGSCv379121,657,100 - 121,657,263UniSTSGRCm37
Celera9122,221,149 - 122,221,312UniSTS
Cytogenetic Map9F4UniSTS
cM Map971.0UniSTS
Is Marker For: Genes:   Nktr  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCATCAGAGTGTCTCGC
Reverse Primer GAAAGTGTTCACAGATAACCTCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1615172Nktrnatural killer tumor recognition sequence9121713881121756842Mouse

Nucleotide Sequences
GenBank Nucleotide AC165080 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL589399 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 18087 UniSTS
UniGene Mm.32842 UniSTS
UniSTS 161612 UniSTS