RH124609 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH124609

Symbol: RH124609
Also known as:
RGD ID: 4936840
Expected Size: 193 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38745,325,437 - 45,325,629UniSTSGRCm38
GRCm389120,574,216 - 120,574,408UniSTSGRCm38
MGSCv379120,483,333 - 120,483,525UniSTSGRCm37
MGSCv37752,580,807 - 52,580,999UniSTSGRCm37
Celera9121,043,819 - 121,044,011UniSTS
Celera740,781,349 - 40,781,541UniSTS
Cytogenetic Map7B4UniSTS
Cytogenetic Map9F4UniSTS
Is Marker For: Genes:   Rpl14   Trpm4   Rpl14-ps1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TATTCTGTGTAGCCTCACGC
Reverse Primer CTAAAGCTAAAGTCCCAGCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1551863Trpm4transient receptor potential cation channel, subfamily M, member 474530315545334071Mouse
2299420Rpl14-ps1ribosomal protein L14, pseudogene 174532495845325651Mouse
1551517Rpl14ribosomal protein L149120571517120574653Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300722Sle3_msystemic lupus erythmatosus susceptibility 3 (mouse)Not determined7346321287493512Mouse
38501068Tip1_mtuberculosis immunophenotype 1, spleen CFU (mouse)7360000072900000Mouse
25314307Mlh1fc2_mMLH1 foci count 2 (mouse)76500000133900000Mouse
10449139Eosn1_meosinophil differential 1 (mouse)71278145246781452Mouse
10449158Eosn3_meosinophil differential 3 (mouse)71278145246781452Mouse
4141566Femwf8_mfemur work to failure 8 (mouse)Not determined1333306047333196Mouse
11522751Cocia17_mcocaine-induced activity, QTL 17 (mouse)71343577947435779Mouse
25314314Sccor1_msynaptonemal complex length to mean MLH1 count ratio 1 (mouse)71360000047700000Mouse
1559016Drsi_mDCC-related Spp1 induction (mouse)Not determined71690336849509583Mouse
10412199Sst2_msusceptibility to tuberculosis 2 (mouse)Not determined718994869119886157Mouse
1301158Eae4_msusceptibility to experimental allergic encephalomyelitis 4 (mouse)Not determined719413473142366067Mouse
1301622Eae12_msusceptibility to experimental allergic encephalomyelitis 12 (mouse)Not determined71958059053580679Mouse
1301052Bhr6_mbronchial hyperresponsiveness 6 (mouse)Not determined72014282554142942Mouse
12904742Litsq2_mlitter size QTL 2 (mouse)72302446357024609Mouse
1301709Bdt4_mbone density traits 4 (mouse)Not determined72323914857239292Mouse
11354952Pdcc1_mplasmacytoid dentritic cell compartment 1 (mouse)72341710757417107Mouse
1301969Lbw5_mlupus NZB x NZW 5 (mouse)Not determined72719819161202351Mouse
12790989Tgl6_mtriglyceride 6 (mouse)72789112561891125Mouse
4141805Sle19_msystematic lupus erythematosus susceptibility 19 (mouse)Not determined3033306081485905Mouse
26884404Huml1_mhumerus length 1, 5 week (mouse)730500000109400000Mouse
1301175Ap7q_malcohol preference 7 QTL (mouse)Not determined73206509766065329Mouse
1300996Aorls2_maortic lesion size 2 (mouse)Not determined73274478466744933Mouse
4141909W10q18_mweight 10 weeks QTL 18 (mouse)Not determined3379830258499217Mouse
4142218W6q17_mweight 6 weeks QTL 17 (mouse)Not determined3379830258499217Mouse
4142102Tailq5_mtail length QTL 5 (mouse)Not determined3379830258499217Mouse
4142003W3q10_mweight 3 weeks QTL 10 (mouse)Not determined3379830258499217Mouse
1357469Kidq5_mkidney weight QTL 5 (mouse)Not determined73379830258499217Mouse
1357731Lvrq6_mliver weight QTL 6 (mouse)Not determined73379830258499217Mouse
1357634Splq7_mspleen weight QTL 7 (mouse)Not determined73379830258499217Mouse
1357883Epfq5_mepididymal fat pad weight QTL 5 (mouse)Not determined73379830258499217Mouse
39128210Lwq19_mliver weight QTL 19 (mouse)73379830258499217Mouse
1559000Ossc1_mosteosarcoma susceptibility 1 (mouse)Not determined73440327768403475Mouse
38501071Stsl6_mSalmonella typhimurium susceptibility locus 6 (mouse)73450000051500000Mouse
10045622Heal20_mwound healing/regeneration 20 (mouse)Not determined73466713968667295Mouse
1357586Mdmsc3_mmodifier of muscularity 3 (mouse)Not determined73479812168798270Mouse
1301514Rigs1_mradiation induced gastroschisis 1 (mouse)Not determined73658059092745138Mouse
1301082Bbaa16_mB.burgdorferi-associated arthritis 16 (mouse)Not determined736580590116817642Mouse
25314301Vmm3_mvariable multisystem mineralization 3, lung (mouse)73760000072400000Mouse
25314303Vmm4_mvariable multisystem mineralization 4, kidney (mouse)73760000087400000Mouse
1300878Skts1_mskin tumor susceptibility 1 (mouse)Not determined73824163872241834Mouse
10402488Dipa2_mdrug induced psychomotor activation 2 (mouse)Not determined73877180072771936Mouse
1300791Abbp3_mA/J and C57BL/6 blood pressure 3 (mouse)Not determined740024463103860803Mouse
4141929Chlq18_mcirculating hormone level QTL 18 (mouse)Not determined74149907275499217Mouse
11252140Fdr1_mfat response to dietary restriction 1 (mouse)74149907275499217Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100040970 UniSTS
  67115 UniSTS
  68667 UniSTS
UniGene Mm.289810 UniSTS
  Mm.395150 UniSTS
  Mm.425436 UniSTS
UniSTS 161431 UniSTS