MT382 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: MT382

Symbol: MT382
Also known as: D9Mit119; 
RGD ID: 4930274
Expected Size: 117 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389116,255,529 - 116,255,645UniSTSGRCm38
MGSCv379116,164,647 - 116,164,763UniSTSGRCm37
Celera9116,718,889 - 116,719,008UniSTS
cM Map965.0UniSTS
Whitehead Genetic963.4UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGACTTTTTAGGTTTCAAATTTTTG
Reverse Primer CAAGTTCAAGGTCAGTATGGACC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC133192 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL591073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4141833W10q13_mweight 10 weeks QTL 13 (mouse)Not determined63332429120362868Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
1357461Idd2_minsulin dependent diabetes susceptibility 2 (mouse)Not determined982910333116910428Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1302103Dob2_mdietary obesity 2 (mouse)Not determined986239845120289624Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
10766454Char10_mP. chabaudi malaria resistance QTL 10 (mouse)982910333116910428Mouse
1357635Splq4_mspleen weight QTL 4 (mouse)Not determined963332429120362868Mouse
1357657Pymr_mPlasmodium yoelli malaria resistance (mouse)Not determined989977005118938021Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1300549Bbaa17_mB. burgdorferi-associated arthritis 17 (mouse)Not determined986230401120230530Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
4141545Tailaq2_mtail length adjusted QTL 2 (mouse)Not determined63332429120362868Mouse
1300884Sluc11_msusceptibility to lung cancer 11 (mouse)Not determined982910333116910428Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
11251716Siim2_mstress induced immobility 2 (mouse)986748483120748483Mouse
12880422V25Dq6_mvitamin D inactive form serum level QTL 6 (mouse)987800000121800000Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301487Nociq1_mnociceptive sensitivity inflammatory QTL 1 (mouse)Not determined984528818118528921Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13515058Adip20d_madiposity 20d (mouse)9108915010118915010Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:703492 UniSTS
UniSTS 131668 UniSTS