D8Mit72 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mit72

Symbol: D8Mit72
Also known as: MPC452; D8Mit72a; D8Mit72b; 
RGD ID: 4930181
Expected Size: 160 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38871,136,855 - 71,137,028UniSTSGRCm38
GRCm38871,856,596 - 71,856,755UniSTSGRCm38
MGSCv37873,660,754 - 73,660,927UniSTSGRCm37
MGSCv37874,380,495 - 74,380,654UniSTSGRCm37
Cytogenetic Map8B3.3UniSTS
cM Map833.0UniSTS
cM Map8 UniSTS
Whitehead Genetic835.0UniSTS
Is Marker For: Genes:   Gm7827   Gm5373  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCAAGACACTCACCCACAGC
Reverse Primer CCAGGGGACCATGAACCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2295106Gm7827predicted gene 782787109170171171456Mouse
10017120Gm38415predicted gene, 3841587116604471206948Mouse
9663874Gm29701predicted gene, 2970187121469671216456Mouse
1613870Aprt-psadenine phosphoribosyl transferase, pseudogene87122391571224450Mouse
1323091Haus84HAUS augmin-like complex, subunit 887125059771272627Mouse
10961Myo9bmyosin IXb87127257671360713Mouse
1332218Use1unconventional SNARE in the ER 1 homolog (S. cerevisiae)87136684871369732Mouse
1558555Ocel1occludin/ELL domain containing 187137129871373689Mouse
733508Nr2f6nuclear receptor subfamily 2, group F, member 687137411871381967Mouse
1322005Ushbp1USH1 protein network component harmonin binding protein 187138427471395834Mouse
1619174Babam1BRISC and BRCA1 A complex member 187139616571404772Mouse
10018131Gm39193predicted gene, 3919387140534871406011Mouse
1550241Ankle1ankyrin repeat and LEM domain containing 187140598671410728Mouse
10005099Gm39192predicted gene, 3919287140958871411115Mouse
10035006Gm39194predicted gene, 3919487141119771415831Mouse
1313871Abhd8abhydrolase domain containing 887145670071464707Mouse
1553633Mrpl34mitochondrial ribosomal protein L3487146492671465753Mouse
1623216Dda1DET1 and DDB1 associated 187146917271476099Mouse
1614781Ano8anoctamin 887147601671486092Mouse
1313351Gtpbp3GTP binding protein 387148614471499624Mouse
733497Plvapplasmalemma vesicle associated protein87149775371511806Mouse
12795236Gm46041predicted gene, 4604187150283671505696Mouse
1611476Ccdc194coiled-coil domain containing 19487152011871525725Mouse
2295015Gm7850predicted gene 785087152355871524326Mouse
1619156Bst2bone marrow stromal cell antigen 287153425571537472Mouse
1331926Mvb12amultivesicular body subunit 12A87154290771548026Mouse
1622659Tmem221transmembrane protein 22187155430371559015Mouse
1317988Nxnl1nucleoredoxin-like 187156055571566649Mouse
1553168Slc27a1solute carrier family 27 (fatty acid transporter), member 187156872871587307Mouse
1625472Pgls6-phosphogluconolactonase87159218471596267Mouse
1615124Niban3niban apoptosis regulator 387159635671608146Mouse
1550707Colgalt1collagen beta(1-O)galactosyltransferase 187161004271624911Mouse
1614780Unc13aunc-13 homolog A87162412571671774Mouse
10031698Gm39195predicted gene, 3919587162951971631262Mouse
9598221Mir6769bmicroRNA 6769b87163104771631106Mouse
10824Jak3Janus kinase 387167638371690577Mouse
732313Insl3insulin-like 387168925271690577Mouse
1313013B3gnt3UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 387169137371702626Mouse
5142689Gm18860predicted gene, 1886087170400571705036Mouse
1317014Fcho1FCH domain only 187170838771729330Mouse
9655070Gm35572predicted gene, 3557287175203071756195Mouse
10009715Gm40504predicted gene, 4050487181598871828412Mouse
2308251Gm5373predicted gene 537387182470071880519Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:701461 UniSTS
NCBI Gene 385024 UniSTS
  665858 UniSTS
UniSTS 131618 UniSTS